ID: 991632477 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:68670118-68670140 |
Sequence | AAAATAGATTTTGATTCAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
991632477_991632479 | 15 | Left | 991632477 | 5:68670118-68670140 | CCTGCTGAATCAAAATCTATTTT | No data | ||
Right | 991632479 | 5:68670156-68670178 | GTGATACTAATGCACATTAAAGG | No data | ||||
991632477_991632478 | -7 | Left | 991632477 | 5:68670118-68670140 | CCTGCTGAATCAAAATCTATTTT | No data | ||
Right | 991632478 | 5:68670134-68670156 | CTATTTTAACAGTATTCACTAGG | No data | ||||
991632477_991632480 | 16 | Left | 991632477 | 5:68670118-68670140 | CCTGCTGAATCAAAATCTATTTT | No data | ||
Right | 991632480 | 5:68670157-68670179 | TGATACTAATGCACATTAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
991632477 | Original CRISPR | AAAATAGATTTTGATTCAGC AGG (reversed) | Intergenic | ||