ID: 991632478

View in Genome Browser
Species Human (GRCh38)
Location 5:68670134-68670156
Sequence CTATTTTAACAGTATTCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632476_991632478 -2 Left 991632476 5:68670113-68670135 CCAGACCTGCTGAATCAAAATCT No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632475_991632478 3 Left 991632475 5:68670108-68670130 CCACTCCAGACCTGCTGAATCAA No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632471_991632478 11 Left 991632471 5:68670100-68670122 CCCGGGCCCCACTCCAGACCTGC No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632473_991632478 5 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632474_991632478 4 Left 991632474 5:68670107-68670129 CCCACTCCAGACCTGCTGAATCA No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632477_991632478 -7 Left 991632477 5:68670118-68670140 CCTGCTGAATCAAAATCTATTTT No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data
991632472_991632478 10 Left 991632472 5:68670101-68670123 CCGGGCCCCACTCCAGACCTGCT No data
Right 991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632478 Original CRISPR CTATTTTAACAGTATTCACT AGG Intergenic