ID: 991632479

View in Genome Browser
Species Human (GRCh38)
Location 5:68670156-68670178
Sequence GTGATACTAATGCACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632473_991632479 27 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC 0: 5
1: 62
2: 302
3: 861
4: 1785
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data
991632475_991632479 25 Left 991632475 5:68670108-68670130 CCACTCCAGACCTGCTGAATCAA No data
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data
991632476_991632479 20 Left 991632476 5:68670113-68670135 CCAGACCTGCTGAATCAAAATCT No data
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data
991632477_991632479 15 Left 991632477 5:68670118-68670140 CCTGCTGAATCAAAATCTATTTT No data
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data
991632474_991632479 26 Left 991632474 5:68670107-68670129 CCCACTCCAGACCTGCTGAATCA 0: 6
1: 87
2: 357
3: 1087
4: 2185
Right 991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632479 Original CRISPR GTGATACTAATGCACATTAA AGG Intergenic
No off target data available for this crispr