ID: 991632480

View in Genome Browser
Species Human (GRCh38)
Location 5:68670157-68670179
Sequence TGATACTAATGCACATTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632473_991632480 28 Left 991632473 5:68670106-68670128 CCCCACTCCAGACCTGCTGAATC No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632476_991632480 21 Left 991632476 5:68670113-68670135 CCAGACCTGCTGAATCAAAATCT No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632475_991632480 26 Left 991632475 5:68670108-68670130 CCACTCCAGACCTGCTGAATCAA No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632477_991632480 16 Left 991632477 5:68670118-68670140 CCTGCTGAATCAAAATCTATTTT No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data
991632474_991632480 27 Left 991632474 5:68670107-68670129 CCCACTCCAGACCTGCTGAATCA No data
Right 991632480 5:68670157-68670179 TGATACTAATGCACATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632480 Original CRISPR TGATACTAATGCACATTAAA GGG Intergenic