ID: 991632597

View in Genome Browser
Species Human (GRCh38)
Location 5:68671391-68671413
Sequence CCTAAGATGCTACCCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991632597_991632601 14 Left 991632597 5:68671391-68671413 CCCTGCCTGGGTAGCATCTTAGG No data
Right 991632601 5:68671428-68671450 TTGAGACCTTCAACTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991632597 Original CRISPR CCTAAGATGCTACCCAGGCA GGG (reversed) Intergenic
No off target data available for this crispr