ID: 991633868

View in Genome Browser
Species Human (GRCh38)
Location 5:68683502-68683524
Sequence CAAGATCATCCCATCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991633868_991633870 -9 Left 991633868 5:68683502-68683524 CCAGGATGGATGGGATGATCTTG No data
Right 991633870 5:68683516-68683538 ATGATCTTGGACAGTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991633868 Original CRISPR CAAGATCATCCCATCCATCC TGG (reversed) Intergenic
No off target data available for this crispr