ID: 991640628

View in Genome Browser
Species Human (GRCh38)
Location 5:68748108-68748130
Sequence TAAATACTGAGGGTGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991640628_991640631 -8 Left 991640628 5:68748108-68748130 CCTCTGTGCACCCTCAGTATTTA No data
Right 991640631 5:68748123-68748145 AGTATTTAAGAACTGAGTTAAGG No data
991640628_991640632 -7 Left 991640628 5:68748108-68748130 CCTCTGTGCACCCTCAGTATTTA No data
Right 991640632 5:68748124-68748146 GTATTTAAGAACTGAGTTAAGGG No data
991640628_991640633 27 Left 991640628 5:68748108-68748130 CCTCTGTGCACCCTCAGTATTTA No data
Right 991640633 5:68748158-68748180 AAAAAAAATCTAGAGTCAAGTGG No data
991640628_991640634 30 Left 991640628 5:68748108-68748130 CCTCTGTGCACCCTCAGTATTTA No data
Right 991640634 5:68748161-68748183 AAAAATCTAGAGTCAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991640628 Original CRISPR TAAATACTGAGGGTGCACAG AGG (reversed) Intergenic
No off target data available for this crispr