ID: 991640629

View in Genome Browser
Species Human (GRCh38)
Location 5:68748118-68748140
Sequence ACTCAGTTCTTAAATACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991640629_991640633 17 Left 991640629 5:68748118-68748140 CCCTCAGTATTTAAGAACTGAGT No data
Right 991640633 5:68748158-68748180 AAAAAAAATCTAGAGTCAAGTGG No data
991640629_991640634 20 Left 991640629 5:68748118-68748140 CCCTCAGTATTTAAGAACTGAGT No data
Right 991640634 5:68748161-68748183 AAAAATCTAGAGTCAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991640629 Original CRISPR ACTCAGTTCTTAAATACTGA GGG (reversed) Intergenic
No off target data available for this crispr