ID: 991640630

View in Genome Browser
Species Human (GRCh38)
Location 5:68748119-68748141
Sequence AACTCAGTTCTTAAATACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991640630_991640633 16 Left 991640630 5:68748119-68748141 CCTCAGTATTTAAGAACTGAGTT No data
Right 991640633 5:68748158-68748180 AAAAAAAATCTAGAGTCAAGTGG No data
991640630_991640634 19 Left 991640630 5:68748119-68748141 CCTCAGTATTTAAGAACTGAGTT No data
Right 991640634 5:68748161-68748183 AAAAATCTAGAGTCAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991640630 Original CRISPR AACTCAGTTCTTAAATACTG AGG (reversed) Intergenic
No off target data available for this crispr