ID: 991640633

View in Genome Browser
Species Human (GRCh38)
Location 5:68748158-68748180
Sequence AAAAAAAATCTAGAGTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991640630_991640633 16 Left 991640630 5:68748119-68748141 CCTCAGTATTTAAGAACTGAGTT No data
Right 991640633 5:68748158-68748180 AAAAAAAATCTAGAGTCAAGTGG No data
991640628_991640633 27 Left 991640628 5:68748108-68748130 CCTCTGTGCACCCTCAGTATTTA No data
Right 991640633 5:68748158-68748180 AAAAAAAATCTAGAGTCAAGTGG No data
991640629_991640633 17 Left 991640629 5:68748118-68748140 CCCTCAGTATTTAAGAACTGAGT No data
Right 991640633 5:68748158-68748180 AAAAAAAATCTAGAGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991640633 Original CRISPR AAAAAAAATCTAGAGTCAAG TGG Intergenic
No off target data available for this crispr