ID: 991640634

View in Genome Browser
Species Human (GRCh38)
Location 5:68748161-68748183
Sequence AAAAATCTAGAGTCAAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991640628_991640634 30 Left 991640628 5:68748108-68748130 CCTCTGTGCACCCTCAGTATTTA No data
Right 991640634 5:68748161-68748183 AAAAATCTAGAGTCAAGTGGAGG No data
991640629_991640634 20 Left 991640629 5:68748118-68748140 CCCTCAGTATTTAAGAACTGAGT No data
Right 991640634 5:68748161-68748183 AAAAATCTAGAGTCAAGTGGAGG No data
991640630_991640634 19 Left 991640630 5:68748119-68748141 CCTCAGTATTTAAGAACTGAGTT No data
Right 991640634 5:68748161-68748183 AAAAATCTAGAGTCAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991640634 Original CRISPR AAAAATCTAGAGTCAAGTGG AGG Intergenic
No off target data available for this crispr