ID: 991641175

View in Genome Browser
Species Human (GRCh38)
Location 5:68754792-68754814
Sequence TAAGACAACCACAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991641169_991641175 27 Left 991641169 5:68754742-68754764 CCACCGAACCACACATGTGAGGG No data
Right 991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG No data
991641171_991641175 24 Left 991641171 5:68754745-68754767 CCGAACCACACATGTGAGGGCAA No data
Right 991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG No data
991641172_991641175 19 Left 991641172 5:68754750-68754772 CCACACATGTGAGGGCAAGCTTC No data
Right 991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG No data
991641173_991641175 -3 Left 991641173 5:68754772-68754794 CCAAGCAGTCTCAATAAGAATAA No data
Right 991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991641175 Original CRISPR TAAGACAACCACAATGAGGT TGG Intergenic
No off target data available for this crispr