ID: 991642405

View in Genome Browser
Species Human (GRCh38)
Location 5:68768186-68768208
Sequence AGATATCTGCACCAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991642394_991642405 11 Left 991642394 5:68768152-68768174 CCTCACTCCCATTGACCTCTCCC No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642397_991642405 3 Left 991642397 5:68768160-68768182 CCATTGACCTCTCCCCCAGGCTG No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642399_991642405 -9 Left 991642399 5:68768172-68768194 CCCCCAGGCTGCTGAGATATCTG No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642400_991642405 -10 Left 991642400 5:68768173-68768195 CCCCAGGCTGCTGAGATATCTGC No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642392_991642405 22 Left 991642392 5:68768141-68768163 CCCTCATCACACCTCACTCCCAT No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642398_991642405 -4 Left 991642398 5:68768167-68768189 CCTCTCCCCCAGGCTGCTGAGAT No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642396_991642405 4 Left 991642396 5:68768159-68768181 CCCATTGACCTCTCCCCCAGGCT No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642391_991642405 25 Left 991642391 5:68768138-68768160 CCACCCTCATCACACCTCACTCC No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data
991642393_991642405 21 Left 991642393 5:68768142-68768164 CCTCATCACACCTCACTCCCATT No data
Right 991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991642405 Original CRISPR AGATATCTGCACCAGTTGGG TGG Intergenic
No off target data available for this crispr