ID: 991646345

View in Genome Browser
Species Human (GRCh38)
Location 5:68804149-68804171
Sequence CTGTCGAAAAGGAGGTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991646345_991646350 1 Left 991646345 5:68804149-68804171 CCAGTTCACCTCCTTTTCGACAG No data
Right 991646350 5:68804173-68804195 CATGTGGCCAAGACAAGCCATGG No data
991646345_991646356 26 Left 991646345 5:68804149-68804171 CCAGTTCACCTCCTTTTCGACAG No data
Right 991646356 5:68804198-68804220 ACCTGACAGGGCCTGAAATGCGG No data
991646345_991646352 13 Left 991646345 5:68804149-68804171 CCAGTTCACCTCCTTTTCGACAG No data
Right 991646352 5:68804185-68804207 ACAAGCCATGGCCACCTGACAGG No data
991646345_991646353 14 Left 991646345 5:68804149-68804171 CCAGTTCACCTCCTTTTCGACAG No data
Right 991646353 5:68804186-68804208 CAAGCCATGGCCACCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991646345 Original CRISPR CTGTCGAAAAGGAGGTGAAC TGG (reversed) Intergenic
No off target data available for this crispr