ID: 991648626

View in Genome Browser
Species Human (GRCh38)
Location 5:68828507-68828529
Sequence GTGGCCTCTACTCCTTCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991648626_991648630 24 Left 991648626 5:68828507-68828529 CCGAGGGAAGGAGTAGAGGCCAC No data
Right 991648630 5:68828554-68828576 ATAACAGCGCACCTGTATGGAGG No data
991648626_991648629 21 Left 991648626 5:68828507-68828529 CCGAGGGAAGGAGTAGAGGCCAC No data
Right 991648629 5:68828551-68828573 AATATAACAGCGCACCTGTATGG No data
991648626_991648631 27 Left 991648626 5:68828507-68828529 CCGAGGGAAGGAGTAGAGGCCAC No data
Right 991648631 5:68828557-68828579 ACAGCGCACCTGTATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991648626 Original CRISPR GTGGCCTCTACTCCTTCCCT CGG (reversed) Intergenic
No off target data available for this crispr