ID: 991648630

View in Genome Browser
Species Human (GRCh38)
Location 5:68828554-68828576
Sequence ATAACAGCGCACCTGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991648628_991648630 -2 Left 991648628 5:68828533-68828555 CCGTCTGCTCATCAAGTCAATAT No data
Right 991648630 5:68828554-68828576 ATAACAGCGCACCTGTATGGAGG No data
991648626_991648630 24 Left 991648626 5:68828507-68828529 CCGAGGGAAGGAGTAGAGGCCAC No data
Right 991648630 5:68828554-68828576 ATAACAGCGCACCTGTATGGAGG No data
991648627_991648630 5 Left 991648627 5:68828526-68828548 CCACGATCCGTCTGCTCATCAAG No data
Right 991648630 5:68828554-68828576 ATAACAGCGCACCTGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991648630 Original CRISPR ATAACAGCGCACCTGTATGG AGG Intergenic
No off target data available for this crispr