ID: 991648631

View in Genome Browser
Species Human (GRCh38)
Location 5:68828557-68828579
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991648626_991648631 27 Left 991648626 5:68828507-68828529 CCGAGGGAAGGAGTAGAGGCCAC No data
Right 991648631 5:68828557-68828579 ACAGCGCACCTGTATGGAGGAGG No data
991648627_991648631 8 Left 991648627 5:68828526-68828548 CCACGATCCGTCTGCTCATCAAG No data
Right 991648631 5:68828557-68828579 ACAGCGCACCTGTATGGAGGAGG No data
991648628_991648631 1 Left 991648628 5:68828533-68828555 CCGTCTGCTCATCAAGTCAATAT No data
Right 991648631 5:68828557-68828579 ACAGCGCACCTGTATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr