ID: 991652665

View in Genome Browser
Species Human (GRCh38)
Location 5:68872055-68872077
Sequence ATGAGGCATCAGGATGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991652665_991652671 17 Left 991652665 5:68872055-68872077 CCAAGGTCATCCTGATGCCTCAT No data
Right 991652671 5:68872095-68872117 ATCTTTCCTCCCTTCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991652665 Original CRISPR ATGAGGCATCAGGATGACCT TGG (reversed) Intergenic
No off target data available for this crispr