ID: 991657005

View in Genome Browser
Species Human (GRCh38)
Location 5:68914073-68914095
Sequence CACAGCAACCACCTTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991657003_991657005 -7 Left 991657003 5:68914057-68914079 CCAAGGTCAGCACCAACACAGCA No data
Right 991657005 5:68914073-68914095 CACAGCAACCACCTTGCTTGAGG No data
991657001_991657005 21 Left 991657001 5:68914029-68914051 CCACGCAGGAATCACAGCAACAT No data
Right 991657005 5:68914073-68914095 CACAGCAACCACCTTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991657005 Original CRISPR CACAGCAACCACCTTGCTTG AGG Intergenic
No off target data available for this crispr