ID: 991658419

View in Genome Browser
Species Human (GRCh38)
Location 5:68926453-68926475
Sequence ACTAAACTGCAGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991658419_991658422 2 Left 991658419 5:68926453-68926475 CCCTCCAGCTTCTGCAGTTTAGT No data
Right 991658422 5:68926478-68926500 AATGCCAAAATGCCCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991658419 Original CRISPR ACTAAACTGCAGAAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr