ID: 991662256

View in Genome Browser
Species Human (GRCh38)
Location 5:68962197-68962219
Sequence CAATGAGAATGGAGAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991662248_991662256 21 Left 991662248 5:68962153-68962175 CCTGAACTGCACTGTTTGGGATG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG No data
991662245_991662256 29 Left 991662245 5:68962145-68962167 CCTGGTTTCCTGAACTGCACTGT 0: 1
1: 0
2: 0
3: 24
4: 211
Right 991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991662256 Original CRISPR CAATGAGAATGGAGAGAAGT AGG Intergenic
No off target data available for this crispr