ID: 991666004

View in Genome Browser
Species Human (GRCh38)
Location 5:69000584-69000606
Sequence GGGTGAATAAACTGTCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991666004_991666012 21 Left 991666004 5:69000584-69000606 CCAGTTGGACAGTTTATTCACCC No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data
991666004_991666011 16 Left 991666004 5:69000584-69000606 CCAGTTGGACAGTTTATTCACCC No data
Right 991666011 5:69000623-69000645 CACAGCTAAACTGTGCCCTGTGG No data
991666004_991666013 30 Left 991666004 5:69000584-69000606 CCAGTTGGACAGTTTATTCACCC No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991666004 Original CRISPR GGGTGAATAAACTGTCCAAC TGG (reversed) Intergenic
No off target data available for this crispr