ID: 991666011

View in Genome Browser
Species Human (GRCh38)
Location 5:69000623-69000645
Sequence CACAGCTAAACTGTGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991666004_991666011 16 Left 991666004 5:69000584-69000606 CCAGTTGGACAGTTTATTCACCC No data
Right 991666011 5:69000623-69000645 CACAGCTAAACTGTGCCCTGTGG No data
991666003_991666011 28 Left 991666003 5:69000572-69000594 CCATGTTTAATGCCAGTTGGACA No data
Right 991666011 5:69000623-69000645 CACAGCTAAACTGTGCCCTGTGG No data
991666006_991666011 -5 Left 991666006 5:69000605-69000627 CCAGTCTACCCCCATAAACACAG No data
Right 991666011 5:69000623-69000645 CACAGCTAAACTGTGCCCTGTGG No data
991666005_991666011 -4 Left 991666005 5:69000604-69000626 CCCAGTCTACCCCCATAAACACA No data
Right 991666011 5:69000623-69000645 CACAGCTAAACTGTGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991666011 Original CRISPR CACAGCTAAACTGTGCCCTG TGG Intergenic
No off target data available for this crispr