ID: 991666012

View in Genome Browser
Species Human (GRCh38)
Location 5:69000628-69000650
Sequence CTAAACTGTGCCCTGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991666005_991666012 1 Left 991666005 5:69000604-69000626 CCCAGTCTACCCCCATAAACACA No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data
991666007_991666012 -8 Left 991666007 5:69000613-69000635 CCCCCATAAACACAGCTAAACTG No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data
991666008_991666012 -9 Left 991666008 5:69000614-69000636 CCCCATAAACACAGCTAAACTGT No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data
991666006_991666012 0 Left 991666006 5:69000605-69000627 CCAGTCTACCCCCATAAACACAG No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data
991666009_991666012 -10 Left 991666009 5:69000615-69000637 CCCATAAACACAGCTAAACTGTG No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data
991666004_991666012 21 Left 991666004 5:69000584-69000606 CCAGTTGGACAGTTTATTCACCC No data
Right 991666012 5:69000628-69000650 CTAAACTGTGCCCTGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991666012 Original CRISPR CTAAACTGTGCCCTGTGGAG AGG Intergenic
No off target data available for this crispr