ID: 991666013

View in Genome Browser
Species Human (GRCh38)
Location 5:69000637-69000659
Sequence GCCCTGTGGAGAGGCACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991666005_991666013 10 Left 991666005 5:69000604-69000626 CCCAGTCTACCCCCATAAACACA No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data
991666010_991666013 -2 Left 991666010 5:69000616-69000638 CCATAAACACAGCTAAACTGTGC No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data
991666007_991666013 1 Left 991666007 5:69000613-69000635 CCCCCATAAACACAGCTAAACTG No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data
991666009_991666013 -1 Left 991666009 5:69000615-69000637 CCCATAAACACAGCTAAACTGTG No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data
991666004_991666013 30 Left 991666004 5:69000584-69000606 CCAGTTGGACAGTTTATTCACCC No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data
991666008_991666013 0 Left 991666008 5:69000614-69000636 CCCCATAAACACAGCTAAACTGT No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data
991666006_991666013 9 Left 991666006 5:69000605-69000627 CCAGTCTACCCCCATAAACACAG No data
Right 991666013 5:69000637-69000659 GCCCTGTGGAGAGGCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991666013 Original CRISPR GCCCTGTGGAGAGGCACCTG TGG Intergenic
No off target data available for this crispr