ID: 991667575

View in Genome Browser
Species Human (GRCh38)
Location 5:69014519-69014541
Sequence TTGAAGACAGAGGTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991667575_991667581 -9 Left 991667575 5:69014519-69014541 CCCAGCCCCACCTCTGTCTTCAA No data
Right 991667581 5:69014533-69014555 TGTCTTCAAAGCCATCAACCAGG No data
991667575_991667583 6 Left 991667575 5:69014519-69014541 CCCAGCCCCACCTCTGTCTTCAA No data
Right 991667583 5:69014548-69014570 CAACCAGGCCCATAAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991667575 Original CRISPR TTGAAGACAGAGGTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr