ID: 991670554

View in Genome Browser
Species Human (GRCh38)
Location 5:69043215-69043237
Sequence TTGGATAGGAATAAGACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991670554_991670559 10 Left 991670554 5:69043215-69043237 CCTTCCGTCTTATTCCTATCCAA No data
Right 991670559 5:69043248-69043270 TTCAATGTATTTGTCGTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991670554 Original CRISPR TTGGATAGGAATAAGACGGA AGG (reversed) Intergenic
No off target data available for this crispr