ID: 991674101

View in Genome Browser
Species Human (GRCh38)
Location 5:69075169-69075191
Sequence GCGGGTGCTGGAAGGCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991674101_991674114 29 Left 991674101 5:69075169-69075191 CCGCGGTGCCTTCCAGCACCCGC No data
Right 991674114 5:69075221-69075243 AATATCTTCACCCGCCTCTTAGG No data
991674101_991674115 30 Left 991674101 5:69075169-69075191 CCGCGGTGCCTTCCAGCACCCGC No data
Right 991674115 5:69075222-69075244 ATATCTTCACCCGCCTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991674101 Original CRISPR GCGGGTGCTGGAAGGCACCG CGG (reversed) Intergenic
No off target data available for this crispr