ID: 991675825

View in Genome Browser
Species Human (GRCh38)
Location 5:69089121-69089143
Sequence CTGGATTATACTGGTTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991675825_991675832 0 Left 991675825 5:69089121-69089143 CCTACATAACCAGTATAATCCAG No data
Right 991675832 5:69089144-69089166 TGGGGGCTGTCCAGTCCCAGTGG No data
991675825_991675834 9 Left 991675825 5:69089121-69089143 CCTACATAACCAGTATAATCCAG No data
Right 991675834 5:69089153-69089175 TCCAGTCCCAGTGGGACTCCAGG No data
991675825_991675833 1 Left 991675825 5:69089121-69089143 CCTACATAACCAGTATAATCCAG No data
Right 991675833 5:69089145-69089167 GGGGGCTGTCCAGTCCCAGTGGG No data
991675825_991675837 13 Left 991675825 5:69089121-69089143 CCTACATAACCAGTATAATCCAG No data
Right 991675837 5:69089157-69089179 GTCCCAGTGGGACTCCAGGTGGG No data
991675825_991675836 12 Left 991675825 5:69089121-69089143 CCTACATAACCAGTATAATCCAG No data
Right 991675836 5:69089156-69089178 AGTCCCAGTGGGACTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991675825 Original CRISPR CTGGATTATACTGGTTATGT AGG (reversed) Intergenic
No off target data available for this crispr