ID: 991676526

View in Genome Browser
Species Human (GRCh38)
Location 5:69094179-69094201
Sequence CGCCGCTGCCGCGGAACAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991676526_991676539 30 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676539 5:69094232-69094254 CGGCGGCGGCTCGTGAGCCCCGG 0: 1
1: 0
2: 1
3: 13
4: 135
991676526_991676530 2 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676530 5:69094204-69094226 ACATGAGGAGACCCCGCGACAGG 0: 1
1: 0
2: 0
3: 3
4: 32
991676526_991676532 4 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676532 5:69094206-69094228 ATGAGGAGACCCCGCGACAGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
991676526_991676533 10 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676533 5:69094212-69094234 AGACCCCGCGACAGGGGCAGCGG 0: 1
1: 0
2: 0
3: 12
4: 156
991676526_991676535 13 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676535 5:69094215-69094237 CCCCGCGACAGGGGCAGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 276
991676526_991676538 16 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676538 5:69094218-69094240 CGCGACAGGGGCAGCGGCGGCGG 0: 1
1: 0
2: 7
3: 69
4: 742
991676526_991676531 3 Left 991676526 5:69094179-69094201 CCCGCTGTTCCGCGGCAGCGGCG 0: 1
1: 0
2: 0
3: 11
4: 87
Right 991676531 5:69094205-69094227 CATGAGGAGACCCCGCGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991676526 Original CRISPR CGCCGCTGCCGCGGAACAGC GGG (reversed) Exonic
900117436 1:1034566-1034588 TGCCGCTGGCGCGGGACACCCGG + Intronic
900255060 1:1693532-1693554 CGGGGCTGCCGCGGGACATCCGG + Intronic
900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG + Intergenic
901024982 1:6274418-6274440 CGCCCCTCCAGCTGAACAGCAGG + Intronic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
913069583 1:115286622-115286644 CGCCGCTGCCGGGGCGCTGCGGG + Exonic
921944920 1:220879818-220879840 CGCGGCTGCCGCAGTCCAGCCGG - Exonic
922748268 1:228059330-228059352 GGCCGCGGCCGCAGCACAGCAGG - Exonic
1065214915 10:23439622-23439644 CGCCGCGGCCGCCGAGCACCGGG + Exonic
1067078059 10:43199221-43199243 TGGCGCTGCCGGGGGACAGCAGG + Intronic
1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG + Intronic
1071695380 10:87863911-87863933 CGCCGCCGCCGCGCCTCAGCCGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1072336493 10:94402835-94402857 CGCGGCGGCCGGGGAGCAGCTGG + Exonic
1086724675 11:90167430-90167452 CGCCGCGGCCGCTGCACAGCCGG + Intronic
1086948379 11:92866764-92866786 GGCCGCTGCCGCAGTCCAGCTGG - Exonic
1089046332 11:115504344-115504366 CGCCGCTGCCGCCGCACACTGGG + Exonic
1090029782 11:123196305-123196327 TCCCGCTGCCGCTGAGCAGCAGG - Intergenic
1091259786 11:134224971-134224993 CGCCGCTGCCGCCGGGCAGTGGG - Exonic
1092669732 12:10849267-10849289 CACCACTGCAGCGGAAGAGCAGG - Intronic
1094841057 12:34342891-34342913 CGCCCCTGCCGCGCAAGCGCGGG + Intergenic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1103400723 12:120641164-120641186 CGCCGCTGCCGCCGGCCCGCGGG + Exonic
1103856248 12:123972897-123972919 CGCCCCTGCCCCGCCACAGCCGG - Intronic
1104925434 12:132311627-132311649 GGCAGCTGCCGTGGGACAGCGGG + Intronic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1118186487 14:63542940-63542962 CTCCGCCGCCGCGGAACCGGAGG - Exonic
1119319095 14:73718881-73718903 CGCCGCCGCCGCCCACCAGCAGG - Exonic
1119808540 14:77498416-77498438 CCGGGCTGCCGCGGACCAGCCGG - Intronic
1122417283 14:101556480-101556502 CTCAGCAGCCGCAGAACAGCAGG + Intergenic
1122637931 14:103138906-103138928 CGCAGCCCCCGCGGAACACCGGG + Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1126849734 15:52789692-52789714 CGCCGCTGCCGCCGTCCAGCAGG + Exonic
1127277164 15:57457340-57457362 TGCTGCTGCTGCAGAACAGCTGG + Intronic
1127606001 15:60589479-60589501 CTCCGCTGCCGCGTGACATCTGG + Intronic
1129344241 15:74906632-74906654 CCCCGCGGCCGTGGAAAAGCGGG - Exonic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1131263576 15:90902812-90902834 CGCCGCTGCCGCGCTCCCGCTGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1141113667 16:81290517-81290539 GGCCGCTTCTGAGGAACAGCGGG + Exonic
1141387016 16:83631037-83631059 CATCTCTGCCGCAGAACAGCTGG + Intronic
1141773939 16:86109845-86109867 TGCCGCTGCCTGGGAACACCTGG + Intergenic
1144991812 17:19238124-19238146 CCCCACTCCCACGGAACAGCGGG + Intronic
1151894501 17:76970875-76970897 CGGCTCTGCCGCTGACCAGCTGG + Intergenic
1151951221 17:77355276-77355298 CGCCGCAGCAGGGGAGCAGCTGG + Intronic
1152605484 17:81287498-81287520 TGCAGCTGACGCGGAGCAGCTGG + Intronic
1152867612 17:82733830-82733852 CAGGGCTGCCGCAGAACAGCAGG - Intergenic
1159219005 18:65435752-65435774 CGCAGCTGACACAGAACAGCAGG + Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161328919 19:3677211-3677233 CGCCACTGCAGCGGAAGTGCTGG + Intronic
1166232441 19:41433023-41433045 CGACGCTGTTGCAGAACAGCAGG - Intronic
925386518 2:3465659-3465681 GGCCGATGCCGCTGAGCAGCTGG - Exonic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
928549511 2:32357277-32357299 CCCCGCCGCCGAGGAGCAGCCGG - Exonic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
936402797 2:112178052-112178074 TGCCTCTGCCTCTGAACAGCTGG - Intronic
938074016 2:128322483-128322505 GGCCGCTGCCCGGGGACAGCAGG + Intergenic
947425542 2:229980173-229980195 CGCCCCTGCCCCTGAATAGCTGG + Intronic
947856263 2:233326644-233326666 TGAGGCTGCCGCTGAACAGCAGG + Intronic
1179539168 21:42073066-42073088 CGGCTCTGCTGCGGACCAGCTGG + Intronic
1180226656 21:46397425-46397447 CGTCACTGCCCTGGAACAGCAGG + Exonic
1183457475 22:37930499-37930521 CGCAGCTGCCGAGGGAAAGCTGG + Intronic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
950829385 3:15859497-15859519 GGCCGCTGCCCGGGACCAGCGGG + Exonic
954838943 3:53494694-53494716 CGCCGCTGGCTCGGGACCGCGGG - Intronic
956452183 3:69385935-69385957 AGCGGCTGCCGCTGAACAGCAGG + Exonic
961081660 3:124033406-124033428 TGCCGCTGCTGGGGGACAGCGGG + Intergenic
961519982 3:127461473-127461495 CTCCGCTGCTGCGGCACGGCAGG + Intergenic
968964372 4:3762098-3762120 AGCCGCAGCCCCGGAAGAGCTGG + Intergenic
969710137 4:8838452-8838474 GGCCCCTGCCGCCGAAAAGCTGG + Intergenic
976751904 4:88457497-88457519 CGCCGCTCCCGGCGAGCAGCTGG - Exonic
978325530 4:107549778-107549800 GGCCTCTGCCGTAGAACAGCTGG + Intergenic
983904436 4:173169211-173169233 AGCCGCTGCCGCGGCAGCGCGGG - Intronic
985679095 5:1246670-1246692 CCCCTCTGCCCCGGGACAGCAGG - Intergenic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
995724679 5:115170263-115170285 CTCCGCTGCAGCAGAGCAGCCGG + Intronic
997926182 5:138032988-138033010 CGACGCAGACGCGGAACAGGGGG + Exonic
998203944 5:140146066-140146088 CTCCGCCGCCGCAGACCAGCCGG + Intergenic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
1018025069 6:159799336-159799358 CGCCTCAGCCTCTGAACAGCTGG - Intergenic
1019280592 7:197922-197944 CACCACTGCCCCGGGACAGCTGG - Intronic
1019546686 7:1580933-1580955 CGGCGCTTTCGCGGAGCAGCCGG - Intergenic
1020270173 7:6590095-6590117 CGCTGCTGCCGCCGGCCAGCAGG - Exonic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1046103903 8:109644688-109644710 CGCCGCTGCCGCCGTCCAGGAGG + Exonic
1047998403 8:130357961-130357983 CGCCGCTGCCGCCGCGCAGCTGG - Intronic
1049013216 8:139901794-139901816 CGGCTCTGCCACGGACCAGCTGG + Intronic
1049780816 8:144428068-144428090 CGCCCCAGCCGAGGAAGAGCCGG + Intronic
1052888894 9:33677197-33677219 CGCCGCCGCCGCGCCTCAGCCGG + Intergenic
1056930129 9:90867343-90867365 CGCGGCTGCCCAGGAACAGCAGG - Intronic
1057258065 9:93567064-93567086 AGCCGTGGCCCCGGAACAGCGGG - Intergenic
1057313424 9:93955166-93955188 CGCCGCCGCCGCCAAACCGCGGG - Exonic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1190024737 X:46912771-46912793 CGCCGCTCCCGCCGCCCAGCCGG - Intronic
1195716823 X:107826233-107826255 CGCCGACGCCGCGCAGCAGCCGG - Exonic
1199248153 X:145630924-145630946 CGGTGCTGGCGCGGAACAGTGGG + Intergenic