ID: 991677851

View in Genome Browser
Species Human (GRCh38)
Location 5:69106474-69106496
Sequence GTGTTGGTAGTGATAAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991677851 Original CRISPR GTGTTGGTAGTGATAAGGTC AGG (reversed) Intronic
900782463 1:4626944-4626966 TTGTGGGTGGTGAGAAGGTCTGG - Intergenic
901120857 1:6892298-6892320 GTGCTGGTAGTGTCAATGTCAGG - Intronic
904831273 1:33307820-33307842 GTGGGGGTAGGGATAAGGTTGGG - Intronic
906575632 1:46886760-46886782 GTGTAGGTTGTGGTAAGGTGAGG + Intergenic
906596344 1:47081136-47081158 GTGTAGGTTGTGGTAAGGTGAGG - Intronic
908092904 1:60705259-60705281 GTGTAGGGAGTGAAAAGGTCAGG + Intergenic
908187104 1:61662911-61662933 TTTTTAGTAGTGATGAGGTCTGG + Intergenic
915788319 1:158640342-158640364 ATGATGGGAGTGATAAGGTCTGG + Intronic
917632127 1:176900830-176900852 GTGTTGGTGGTGAGCAGGGCAGG - Intronic
921014384 1:211175155-211175177 ATGTTGGTAGTGATAGTGACAGG + Intergenic
922170758 1:223152522-223152544 ATGCTGATAGTGATAAGGACAGG + Intergenic
922428731 1:225525790-225525812 GTGGTGGGAGTGACAAGGTGGGG - Intronic
923442273 1:234031845-234031867 GTGTTGGTAAAGATAATGTTTGG - Intronic
924804376 1:247350664-247350686 TTTTTGGTAGAGATGAGGTCTGG - Intergenic
1064539072 10:16387862-16387884 GTGTTGGTAGAGATTGGGCCAGG - Intergenic
1069007262 10:63331913-63331935 ATGTTGGTTGTTAAAAGGTCGGG - Intronic
1069468392 10:68662722-68662744 TTTTTGGTAGAGATGAGGTCTGG - Intronic
1069663183 10:70137419-70137441 GTGTGGGTACTGATATGGTTTGG - Intergenic
1069924107 10:71836437-71836459 GTGGTGGGAGTCATCAGGTCTGG - Intronic
1070192199 10:74121508-74121530 GTGGTGGTAGTGATAGGGAAGGG + Intergenic
1072246020 10:93544673-93544695 TTATTTGTAGTGACAAGGTCTGG + Intergenic
1077816455 11:5690523-5690545 GAGTTGGTACTGATAACGCCTGG + Intronic
1081246491 11:40772426-40772448 CAGGTGGTAGTGATATGGTCAGG - Intronic
1082765238 11:57162586-57162608 GTGTTCTTATTGATCAGGTCTGG + Intergenic
1083364675 11:62134233-62134255 ATTTTGGTAGAGATAGGGTCTGG - Intronic
1084387356 11:68852329-68852351 TTTTTGGTAGAGACAAGGTCTGG - Intergenic
1085199652 11:74694074-74694096 GTGTTGCCAGTGCTAAGGGCAGG - Intergenic
1085869361 11:80331141-80331163 GTGTTGGTAGTGATGTGGGAAGG + Intergenic
1090883255 11:130853323-130853345 GTGCTGGCAATGAAAAGGTCTGG - Intergenic
1094663446 12:32494684-32494706 GAGTTGGTTGTGAGAAGGCCAGG + Intronic
1094692823 12:32786389-32786411 GTGGTGGTAGTGGTAGGGTCAGG + Intergenic
1097690961 12:62734203-62734225 GTGCTGGTAGAGTCAAGGTCTGG - Intronic
1099117969 12:78650951-78650973 GTTTTGGTAGAGAAAAGGTTTGG - Intergenic
1104757180 12:131276639-131276661 GTGTGGGCAGTGCTAAGGACAGG - Intergenic
1106234171 13:27847780-27847802 GTGTTAGTAGAGGTGAGGTCAGG + Intergenic
1109435831 13:62300657-62300679 TTATTGGAAGTGATGAGGTCTGG - Intergenic
1110779555 13:79449188-79449210 GTGATGGTTGTGAGAAGGTAAGG + Intergenic
1112795636 13:103053985-103054007 GTTTTGGGAGTGATATGGTTTGG + Intronic
1117748664 14:58898088-58898110 CTGTGGGAAGTGATTAGGTCAGG - Intergenic
1118827192 14:69394702-69394724 GGGTTGGAAGTGATAAAGGCAGG + Intronic
1125801041 15:42447429-42447451 TTGCTGGTAGTGATACAGTCTGG - Intronic
1128328298 15:66739393-66739415 GTGTTGGCAGTTAGAAGGCCTGG - Intronic
1128395559 15:67221919-67221941 TTATTGGTAATAATAAGGTCTGG - Intronic
1129219901 15:74126095-74126117 GTGGTGGTGGTGAAGAGGTCTGG + Intronic
1129934907 15:79439394-79439416 GTGTGGGTAGTGATGAGATGTGG + Intronic
1129934915 15:79439433-79439455 GTGTGGGTAGTGATGAGATGTGG + Intronic
1130667683 15:85883661-85883683 GAGTTGGTGGTGATGAGGTGTGG + Intergenic
1133362973 16:5188547-5188569 GAGTTGGTACTGATAACGCCTGG + Intergenic
1135979386 16:27135469-27135491 GAGTTGGTATTGATAATGCCTGG - Intergenic
1138769227 16:59643121-59643143 GTTTTGGTATTGATATGGTTTGG + Intergenic
1146769351 17:35554495-35554517 GTGTTAGTAGTAATGAGTTCAGG - Intronic
1153385660 18:4492549-4492571 TTTTTGGTAGTGATATGGTTTGG + Intergenic
1157298858 18:46465375-46465397 GGGTAGATATTGATAAGGTCTGG - Intergenic
1158500362 18:57995482-57995504 GTGATGGTAGTGGGAAGGGCAGG + Intergenic
1159629212 18:70730168-70730190 GGGTAGGTAGTGATATGGTTTGG + Intergenic
1159759735 18:72409264-72409286 TTTTTGGTAGAGATAAGGTTTGG - Intergenic
1162036847 19:7944878-7944900 GTGTTGCTAAGAATAAGGTCTGG + Intergenic
1162246274 19:9404204-9404226 GTTTTGGCAGTGATATGGTTTGG - Intergenic
926946434 2:18192379-18192401 GTGTTGGGAGAGATGAGGTGGGG + Intronic
926975338 2:18511018-18511040 GTGTTGGTGGTGGTAATGGCAGG - Intergenic
927080617 2:19626171-19626193 GTGTTGGTGGTGATAAGGGTGGG - Intergenic
927265025 2:21136800-21136822 GTCATGCCAGTGATAAGGTCTGG + Intronic
927380903 2:22477776-22477798 GTAGTGGTAGTGATAGGGTAAGG + Intergenic
933359488 2:81261310-81261332 GTGTTCTTACTGATAATGTCAGG - Intergenic
939008637 2:136819414-136819436 GTGTTTGGATTGATAAAGTCTGG - Intronic
940932542 2:159450915-159450937 GTTTTGGTAGAGATGAGGTTTGG + Intronic
941193014 2:162410503-162410525 GTGTTGGTAATGATATGGCCTGG - Intronic
944822373 2:203443800-203443822 TTTTTGGTAGAGACAAGGTCTGG - Exonic
1169662640 20:7997467-7997489 GAGTTGGTACTGATAATGGCTGG - Intronic
1172086822 20:32391664-32391686 TTTTTAGTAGAGATAAGGTCTGG + Intronic
1175323619 20:58107365-58107387 CTATTGGTAGGGATAAGGTGGGG - Intergenic
1177748088 21:25245608-25245630 GTTTTGGTGGTGATATGGTTTGG + Intergenic
1180932090 22:19599181-19599203 TTGTTTGTAGAGATAGGGTCTGG + Intergenic
1181689980 22:24553854-24553876 ATGTTGGGGGTGATAAGGTTAGG + Intronic
1184493428 22:44823694-44823716 GTGGTGGAAGTGATTTGGTCTGG + Intronic
949919852 3:8992017-8992039 GTGGTGGAATTGAGAAGGTCAGG - Intronic
952246627 3:31600588-31600610 CTGTTTATATTGATAAGGTCAGG + Intronic
954919412 3:54176867-54176889 GTGTTGGTGGTGATTATTTCAGG + Intronic
957036238 3:75295752-75295774 TGGTGGGTAGTGATGAGGTCAGG + Intergenic
957528503 3:81409282-81409304 ATGTATGTAGTGATAAGATCTGG + Intergenic
957690334 3:83558026-83558048 GTTGTGGTAGTGGTAAGGTGTGG + Intergenic
958622349 3:96577301-96577323 GTGTTGGAAGTGGTAAGAACTGG - Intergenic
961079984 3:124018207-124018229 TGGTAGGTAGTGATGAGGTCAGG + Intergenic
964221700 3:154354351-154354373 GAGCTCTTAGTGATAAGGTCAGG + Intronic
965244295 3:166248001-166248023 GTATTGCCAGTGATATGGTCTGG + Intergenic
965638886 3:170812436-170812458 GTTTTGGGAGTGAGAAGGCCTGG - Intronic
967846230 3:194045285-194045307 GTGTGGGCAGTGATAAGGGGAGG - Intergenic
970071804 4:12167816-12167838 GTATTGGAAGTGATAGGGCCAGG - Intergenic
972320715 4:37971072-37971094 GTTTTGGTGGGGATATGGTCAGG + Intronic
976059175 4:81106566-81106588 ATGATGGTAGTGAGAAAGTCAGG + Intronic
979473693 4:121130016-121130038 GTCTTGGTTGTGATATGGTTAGG - Intergenic
983965155 4:173800726-173800748 GTGTTGGTTATGATATGGTTTGG + Intergenic
986039097 5:3969596-3969618 GTCATGGTGGTGATAAGGTGTGG - Intergenic
987429489 5:17815031-17815053 TTTTTGGTAGAGACAAGGTCTGG + Intergenic
991677851 5:69106474-69106496 GTGTTGGTAGTGATAAGGTCAGG - Intronic
994003688 5:94812427-94812449 GTGCTGTTTGTGATTAGGTCAGG + Intronic
998169941 5:139866747-139866769 CTGTGGGTAGAGACAAGGTCAGG - Intronic
998261931 5:140638368-140638390 GAGCTGGTACTGATAACGTCTGG + Intergenic
1000234512 5:159344921-159344943 GGGTTTGTACTGATAAGGACAGG - Intergenic
1002104684 5:176874290-176874312 GTGGTGGTGGTGCTGAGGTCCGG - Exonic
1005056888 6:21737754-21737776 TTGTGGGTAGGGATAAGGTAGGG + Intergenic
1012610129 6:101207516-101207538 CTCTTGATAGTGTTAAGGTCAGG - Intergenic
1013625999 6:111937510-111937532 GTTTTAGTAGAGACAAGGTCTGG - Intergenic
1013774416 6:113663745-113663767 GTTTTTGTAGAGATAGGGTCTGG - Intergenic
1015702874 6:136055256-136055278 GTGTGGGGAGTGAGAAGGGCAGG + Intronic
1017566940 6:155697255-155697277 CTGTTGTTAGTTACAAGGTCAGG + Intergenic
1018130025 6:160720925-160720947 GTGTTGGTTTGGATAAGTTCTGG + Intronic
1023420294 7:39971941-39971963 CTGTTGATATTAATAAGGTCTGG + Intronic
1031117208 7:117681437-117681459 GTGATGGTAATGACAAAGTCAGG + Intronic
1031774462 7:125890211-125890233 TTGTTGCTAGTGATATGGTTTGG + Intergenic
1032373206 7:131381609-131381631 GTGGTGGTAGTGATGAGGTCAGG - Intronic
1034209460 7:149350176-149350198 CTTTGGGTAGTGATATGGTCTGG - Intergenic
1035260994 7:157661630-157661652 AGGTTGGCAGTGATAAGGCCAGG + Intronic
1036603226 8:10282701-10282723 CACTTGGTAGTGATAAGGTCTGG - Intronic
1041659196 8:60384543-60384565 GTGCTGGAAGTTATAAGGTAAGG - Intergenic
1043066439 8:75576807-75576829 CTGCAGGTAGTGATAAGGTGTGG - Intergenic
1049601561 8:143510079-143510101 GTGCTGGCAGTGGTCAGGTCAGG + Intronic
1053234653 9:36442118-36442140 GAGTTGGTAGTGATGAGATTAGG - Intronic
1055630987 9:78223060-78223082 GAGTTTGGAGTGCTAAGGTCTGG - Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1060101846 9:120847393-120847415 GTGTGGGGAGTGCTAGGGTCAGG + Intergenic
1060676494 9:125519922-125519944 CTGTGGGTAGAGAAAAGGTCTGG + Intronic
1185760253 X:2685068-2685090 GTGCTGGTGGTGATATGGTTTGG - Intergenic
1188608331 X:32062148-32062170 TTGTTGATATTTATAAGGTCTGG + Intronic
1189662554 X:43317577-43317599 GTCTTGGTCCTTATAAGGTCAGG - Intergenic
1189882737 X:45508963-45508985 GTTTTGGTGGTGATAGGGTGTGG + Intergenic
1192826989 X:74707611-74707633 GAGTTGGGAGTGATAAGGGGAGG + Intergenic
1193418906 X:81259490-81259512 GTAATGGTAGTGATAAGGGCAGG + Intronic
1194916350 X:99714066-99714088 GTGCTGAGAATGATAAGGTCTGG + Intergenic
1195487476 X:105425665-105425687 GAGTTGGAAAAGATAAGGTCAGG - Intronic