ID: 991678738

View in Genome Browser
Species Human (GRCh38)
Location 5:69116468-69116490
Sequence TCACCCATGAAGTTATAAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991678738_991678740 21 Left 991678738 5:69116468-69116490 CCTCTTTATAACTTCATGGGTGA 0: 1
1: 0
2: 1
3: 14
4: 165
Right 991678740 5:69116512-69116534 ATCGATCCCTAGGTTTATTAAGG 0: 1
1: 0
2: 0
3: 3
4: 53
991678738_991678739 11 Left 991678738 5:69116468-69116490 CCTCTTTATAACTTCATGGGTGA 0: 1
1: 0
2: 1
3: 14
4: 165
Right 991678739 5:69116502-69116524 ATAGCTCTCAATCGATCCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991678738 Original CRISPR TCACCCATGAAGTTATAAAG AGG (reversed) Exonic
902941245 1:19801413-19801435 CCACCCATGAAGTTATTGTGAGG + Intergenic
903402162 1:23062253-23062275 TCACACAGGCAGTTAGAAAGAGG - Intronic
904766009 1:32847602-32847624 TCACTTATGAAGTGATACAGGGG - Intronic
908708396 1:66987834-66987856 TCACCCAAGATGTGGTAAAGGGG - Intronic
909810968 1:79931478-79931500 TGACCCATTTAGCTATAAAGTGG + Intergenic
910370651 1:86512270-86512292 TGATCCATCTAGTTATAAAGTGG + Intergenic
910630236 1:89346394-89346416 TGACCCATCTAGTCATAAAGTGG + Intergenic
910790337 1:91043862-91043884 TGACCCATCTAGCTATAAAGTGG + Intergenic
911170924 1:94770181-94770203 TCACCCACAAAGTTCTGAAGTGG + Intergenic
917783422 1:178425318-178425340 TCACCCATTAAGTTAAAAACTGG - Intronic
918824711 1:189309586-189309608 TTACCCCTAAAGGTATAAAGGGG - Intergenic
923278830 1:232421784-232421806 TGCCCCTTGAAGTTAAAAAGTGG - Intronic
923984693 1:239368140-239368162 TATTCCATGAAATTATAAAGAGG + Intergenic
1063959121 10:11292397-11292419 TCACCCTTGAAGTTATCCTGTGG + Intronic
1066693222 10:38053659-38053681 TCAGGAATGAAGTTGTAAAGAGG - Intronic
1066999573 10:42595398-42595420 TCAGGAATGAAGTTGTAAAGAGG + Intronic
1068447224 10:57138734-57138756 TGACCCATCTAGTTATAAAGTGG + Intergenic
1068950729 10:62774535-62774557 TCATCCCTGAAGTTTTAAAGGGG - Intergenic
1069192291 10:65506228-65506250 TGACCCATCTAGTCATAAAGTGG - Intergenic
1070413808 10:76170179-76170201 TCACCCAAGAAGGTATAAACTGG + Intronic
1072115955 10:92370472-92370494 TCACCAAAGAAGTTATACAATGG + Intergenic
1072514027 10:96159599-96159621 TCAGGCAAGAAGGTATAAAGAGG - Exonic
1073924202 10:108496151-108496173 TCACCAAAGAATGTATAAAGGGG + Intergenic
1074645348 10:115444769-115444791 TCACCCAGGAAGGAATACAGTGG + Intronic
1075606800 10:123817541-123817563 TGACCCATCTAGTCATAAAGTGG + Intronic
1077292509 11:1804396-1804418 TCACTTATGAAGTTAGAAAAAGG - Intergenic
1083254770 11:61489368-61489390 CCACCCTTGAACTTATGAAGAGG - Intronic
1086011548 11:82109794-82109816 AAACCCATGAAGTTTTAAGGGGG - Intergenic
1086263903 11:84974878-84974900 GCAACCTTGAAGTTATAAATAGG + Intronic
1086814210 11:91348513-91348535 TCACCCAGGTAGATATATAGGGG - Intergenic
1086855290 11:91858657-91858679 TCACCCTTGAATTTATAACTGGG + Intergenic
1087748890 11:101983408-101983430 TCAACCATGAAGTCAAAGAGTGG + Intronic
1089655044 11:119941104-119941126 TCACTCATGAAGTTATACCTGGG - Intergenic
1090119183 11:124006257-124006279 TGACCCATATAGTCATAAAGTGG - Intergenic
1091205903 11:133820914-133820936 TCACAGATGTAGTTGTAAAGAGG + Intergenic
1093475833 12:19553404-19553426 TCTCCCATAAAATTATACAGGGG - Intronic
1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG + Intergenic
1095608756 12:44102353-44102375 TAACCCATGTAGGTATGAAGAGG + Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099578088 12:84405508-84405530 TAACCCATGTAGCCATAAAGTGG + Intergenic
1100767609 12:97884989-97885011 TCACCCAGGAAATTAGAAAAGGG + Intergenic
1101701627 12:107179353-107179375 TCACCCAGGAAGTAGTATAGTGG - Intergenic
1103361646 12:120358129-120358151 TCACACAGCAAGTTAGAAAGTGG + Intronic
1105652916 13:22400192-22400214 ATACCCATGAAGTTATAAGCAGG - Intergenic
1109093493 13:58079772-58079794 TCACCCATGAATGGATAAATAGG - Intergenic
1109280102 13:60345899-60345921 ACAACCATGAAGTGATAATGAGG + Intergenic
1109841600 13:67923386-67923408 TTATCTATGAAGTTAGAAAGGGG - Intergenic
1110647058 13:77899726-77899748 TCATCCATGATGTAATAAAAGGG + Intronic
1112693461 13:101920261-101920283 TTACCTTTGACGTTATAAAGAGG + Intronic
1115922489 14:38391881-38391903 CCACCCATGATGTGCTAAAGAGG + Intergenic
1116476337 14:45344842-45344864 TCAGCCATGACTTTTTAAAGAGG - Intergenic
1116660131 14:47699536-47699558 TCTCACATGAACTTATACAGTGG - Intergenic
1116840065 14:49810947-49810969 TCACCCAGGCTGTAATAAAGTGG - Intronic
1117216855 14:53560292-53560314 TGACCCATCAAGCCATAAAGTGG + Intergenic
1117634144 14:57724490-57724512 TGACCCATCAAGCCATAAAGTGG + Intronic
1120319273 14:82938577-82938599 TCGTCCATGAAGTTAGAAATTGG - Intergenic
1128553683 15:68615553-68615575 TAACCCCTAAAGTTATTAAGAGG + Intronic
1131645156 15:94334092-94334114 TCACTACTGAAGTTATAAAGGGG - Intronic
1131911919 15:97215407-97215429 TCACCCATTTAATTATAATGAGG - Intergenic
1138293825 16:55870031-55870053 TCACTTATGAAGTTATCATGAGG + Intronic
1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG + Exonic
1138809242 16:60129406-60129428 TCACCAATGAAATTATACTGAGG - Intergenic
1144483801 17:15648506-15648528 TCAGCCATGAAGACACAAAGTGG - Intronic
1144529976 17:16028067-16028089 TCCAGCATGAAGTTGTAAAGTGG + Exonic
1147696776 17:42361060-42361082 TTCCCCATGAAGTAATACAGAGG + Intronic
1148883617 17:50754334-50754356 TCACTCATGAAGTATAAAAGTGG - Exonic
1149042471 17:52206231-52206253 TAAACCCTGAAGTTTTAAAGAGG - Intergenic
1151862288 17:76773509-76773531 TCACCAAAGAAGATATAAAGAGG - Intronic
1156681982 18:39601377-39601399 TCAGGAATGAAATTATAAAGAGG - Intergenic
1159075475 18:63676842-63676864 TCATCCCTAAAGTTATTAAGGGG + Intronic
1159411958 18:68089260-68089282 TCTTACATGAACTTATAAAGAGG - Intergenic
927008732 2:18879837-18879859 TGACCCATCTAGCTATAAAGTGG + Intergenic
927017992 2:18987272-18987294 TCACCCAGTAAATTATCAAGTGG - Intergenic
929200641 2:39231875-39231897 TCACCCAGGAAGTAATACAGTGG - Intergenic
932458460 2:71865107-71865129 TCCCCCAAGATGTTATAAAAGGG - Intergenic
934593370 2:95579370-95579392 TTACCCTTCAAGTTATAAACTGG - Intergenic
935150555 2:100431287-100431309 TCACACATGAACTCATAGAGTGG + Intergenic
935841645 2:107118723-107118745 TCACTCATAAAGTGATAAATAGG - Intergenic
938752835 2:134350868-134350890 TCATCTCAGAAGTTATAAAGTGG - Intronic
938896811 2:135760136-135760158 TCACCCATAAAGTTACACATGGG + Intronic
939418511 2:141933854-141933876 TTACTCATGAATTTATAAATGGG - Intronic
939532276 2:143379019-143379041 TGAACCATGAAGTTTTAAATGGG + Intronic
939788674 2:146545998-146546020 TCACCCATCTAGCCATAAAGTGG - Intergenic
943886524 2:193224651-193224673 TCTCCAACGAAGATATAAAGTGG - Intergenic
944351163 2:198728674-198728696 TTACCAATGAAGGTATAAAATGG + Intergenic
945037050 2:205713154-205713176 TCACCCATGGAGTCATTTAGGGG - Intronic
945642190 2:212443952-212443974 TGACCCATCAAGCCATAAAGTGG + Intronic
945725833 2:213471380-213471402 TGACCCATCTAGTCATAAAGTGG - Intronic
946407377 2:219498792-219498814 TCTCCCATAAAGTTAGAAAGCGG + Intergenic
1171767837 20:29300147-29300169 TCAACCATGTAGGTAGAAAGTGG + Intergenic
1178202512 21:30423485-30423507 AAATCCATGAAGTTATAAAAAGG + Intronic
1182894276 22:33845987-33846009 TCACCAAGGAAATTGTAAAGGGG - Intronic
1182973352 22:34598636-34598658 TCATGCAGGAAGTTTTAAAGAGG - Intergenic
949478069 3:4467456-4467478 TCAACCAAGAAATCATAAAGGGG - Intergenic
949492976 3:4607070-4607092 TCACCCATGAAAATATCCAGAGG - Intronic
950310274 3:11951885-11951907 TCACCCATGCAGTTCCAAGGGGG - Intergenic
952095768 3:29951305-29951327 TCACACATGCAGTTTTAAACAGG + Intronic
952160948 3:30692402-30692424 CAACCCATGAAGGTAAAAAGTGG - Exonic
954994271 3:54867193-54867215 TCTCCCATGCAGTTTTAAAAGGG - Intronic
956801350 3:72762288-72762310 TCACCCTTGAATTTCTTAAGTGG - Intronic
958071224 3:88615592-88615614 TCACCCAAGACGTTATGCAGTGG + Intergenic
959106511 3:102070996-102071018 AATCCCATGAAGTAATAAAGAGG + Intergenic
960214504 3:115014909-115014931 TCACCCATAAACTTATAAAGTGG + Intronic
960677465 3:120210183-120210205 TCAACCATGAAGTTAGAAAATGG + Intronic
960899439 3:122540005-122540027 TCGCCAATGAAGTTATACATTGG - Intronic
961126781 3:124425896-124425918 CCACTCATGAAATTATAAATGGG - Intronic
962071845 3:132041836-132041858 TAACCCATGAGGAAATAAAGAGG + Intronic
966399448 3:179533753-179533775 TCACCAAAGAAGATATACAGAGG - Intergenic
968783412 4:2600439-2600461 GCAGTCATGAAGTTATGAAGAGG - Intronic
970632557 4:17966650-17966672 TCACCCAAGAAGATACATAGTGG + Intronic
974262359 4:59542155-59542177 TCACCCATCTAGCCATAAAGTGG - Intergenic
977490059 4:97699957-97699979 TGACCCATGTAGCCATAAAGTGG - Intronic
980631358 4:135439142-135439164 TAACCCATGAAATTATTCAGGGG + Intergenic
982377076 4:154704566-154704588 TCACCAAAAAAGTTATACAGAGG + Intronic
985008860 4:185562022-185562044 GCAACCATGAATTTACAAAGAGG - Intergenic
986087121 5:4462832-4462854 TGACCCATGTAGCCATAAAGTGG + Intergenic
986743024 5:10720302-10720324 TGACCCATCAAGCCATAAAGTGG - Intronic
987657125 5:20821537-20821559 TGACCCATCTAGTCATAAAGTGG - Intergenic
988766426 5:34382411-34382433 TGACCCATCTAGTCATAAAGTGG + Intergenic
989045195 5:37267476-37267498 TGACCCATCTAGTTATAAACTGG - Intergenic
990879754 5:60526148-60526170 TCACCAATGTAGTTATCTAGTGG - Intergenic
991228185 5:64297507-64297529 TAACCCATGAATTTATATAAAGG - Intronic
991678738 5:69116468-69116490 TCACCCATGAAGTTATAAAGAGG - Exonic
992242968 5:74789982-74790004 TGACCCATCTAGTCATAAAGTGG + Intronic
995313133 5:110736120-110736142 TAAAACATGAATTTATAAAGTGG - Intronic
996217071 5:120882070-120882092 TTACCCAGGAAGTTACAACGTGG + Intergenic
997435843 5:133874658-133874680 TCACCCAGGCAGGAATAAAGTGG + Intergenic
999351397 5:150874960-150874982 TGACCCATGTAGCCATAAAGTGG + Intronic
999840397 5:155419014-155419036 TCACTCATGAATTTTTATAGTGG - Intergenic
1003284677 6:4724356-4724378 TCACCTTTGGAATTATAAAGAGG - Intronic
1006711884 6:36080867-36080889 TCACCCAAGTAGTTACAAAGTGG + Intronic
1008400300 6:51055580-51055602 TGACCCATGTAGTCATAAAGTGG + Intergenic
1009192411 6:60645407-60645429 GCAACCAAGAAGTTATAAAAGGG + Intergenic
1010104616 6:72152002-72152024 TCTCCCATGAACTCATAAGGAGG + Intronic
1011069115 6:83361781-83361803 TGACCCATGTAGCCATAAAGTGG + Intronic
1013594572 6:111649072-111649094 TCACCCAGGATGGAATAAAGTGG - Intergenic
1013729111 6:113142010-113142032 TCAGCCATGAATTTATGCAGAGG + Intergenic
1014468562 6:121786005-121786027 AAATCCATGAAGTTATTAAGTGG - Intergenic
1014625199 6:123716330-123716352 TCAGCTATGAAGTTCTAATGTGG + Intergenic
1016011445 6:139141490-139141512 TAACACATGAAGTAATTAAGTGG - Intronic
1016144303 6:140649518-140649540 TGACCCATCTAGTTATAAAGTGG + Intergenic
1016455255 6:144224213-144224235 TAACAAATGAAGTTTTAAAGTGG + Intergenic
1017026181 6:150183279-150183301 TCATCCCTGAAATTATAAAGAGG + Intronic
1017508816 6:155093797-155093819 TCAGGCATGAATTTAGAAAGGGG - Intronic
1020392787 7:7676269-7676291 TACCCCATGAAGTTATTGAGGGG + Intronic
1021158048 7:17236287-17236309 TCACCCAGGAATTTAAAAGGAGG - Intergenic
1021467327 7:20959841-20959863 TGATGCATGAAGTTATAAACAGG + Intergenic
1022224653 7:28350444-28350466 TCTCCTATGAAGTTTTAAGGAGG - Intronic
1022687973 7:32614334-32614356 CCACCCAAAAAATTATAAAGAGG + Intergenic
1024484518 7:49902975-49902997 TCACAGATGAAGATATAAAATGG + Intronic
1025145594 7:56499327-56499349 AAACACATGAAGTTCTAAAGCGG + Intergenic
1025261417 7:57421531-57421553 AAACACATGAAGTTCTAAAGCGG + Intergenic
1025738738 7:64178727-64178749 AAACACATGAAGTTCTAAAGCGG + Intronic
1029961267 7:104691163-104691185 TCACCCATCTAGCCATAAAGTGG + Intronic
1030277469 7:107736229-107736251 TGACCCATCTAGCTATAAAGTGG + Intergenic
1031596380 7:123654259-123654281 TCACCAAAGAAGATATAAGGTGG + Intergenic
1031741520 7:125437707-125437729 TCACCCATTAAGTCAGATAGGGG + Intergenic
1032153095 7:129446843-129446865 TGACCCATCAAGCCATAAAGTGG - Intronic
1035302283 7:157905433-157905455 TCTCCCATGAAGATAAAAACGGG - Intronic
1038332609 8:26621106-26621128 TCCCCCAAAAAGTTTTAAAGTGG - Intronic
1043396021 8:79837756-79837778 TCACCAAAGAAGATATAAACAGG + Intergenic
1044652286 8:94508933-94508955 TAACCCATGAAACTATAAACTGG + Intronic
1044875524 8:96662066-96662088 TTACCAAAGAAGATATAAAGTGG - Intronic
1046535220 8:115500562-115500584 TCACACATCAAGTGATAAACTGG - Intronic
1046585775 8:116147605-116147627 TGACCCATGTAGCCATAAAGTGG - Intergenic
1050247656 9:3707923-3707945 TCACTGGTGAAGTTTTAAAGTGG - Intergenic
1052195084 9:25702334-25702356 TCAAAAATGAAGTTCTAAAGTGG - Intergenic
1052490660 9:29162359-29162381 TCAAACATGAATTCATAAAGTGG - Intergenic
1056192919 9:84202420-84202442 TCACCAAAGAAGATATACAGAGG + Intergenic
1190018024 X:46845530-46845552 TCACCAATCAAGATATAAAATGG + Intronic
1191946365 X:66539124-66539146 TGACCCATCTAGTCATAAAGTGG + Intergenic
1193447166 X:81618883-81618905 TCACCCATCTAGCCATAAAGTGG + Intergenic
1194833970 X:98658915-98658937 TGACCCATCTAGCTATAAAGTGG + Intergenic
1198076886 X:133202195-133202217 CCACCCTAGTAGTTATAAAGTGG + Intergenic
1199144433 X:144348853-144348875 TGACCCATCTAGCTATAAAGTGG - Intergenic
1199310413 X:146314288-146314310 TAACCCATCTAGTCATAAAGTGG - Intergenic
1201077263 Y:10197244-10197266 TCAACCATGTAGGTAGAAAGCGG - Intergenic
1202168777 Y:22019133-22019155 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG + Intergenic
1202320531 Y:23628425-23628447 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG + Intergenic