ID: 991682366

View in Genome Browser
Species Human (GRCh38)
Location 5:69151791-69151813
Sequence CTGTATATATAGATTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991682361_991682366 11 Left 991682361 5:69151757-69151779 CCCAAGCCCAGTAATGCTGTAGA No data
Right 991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG No data
991682360_991682366 12 Left 991682360 5:69151756-69151778 CCCCAAGCCCAGTAATGCTGTAG No data
Right 991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG No data
991682362_991682366 10 Left 991682362 5:69151758-69151780 CCAAGCCCAGTAATGCTGTAGAT No data
Right 991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG No data
991682363_991682366 5 Left 991682363 5:69151763-69151785 CCCAGTAATGCTGTAGATCTATA No data
Right 991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG No data
991682364_991682366 4 Left 991682364 5:69151764-69151786 CCAGTAATGCTGTAGATCTATAT No data
Right 991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG No data
991682359_991682366 22 Left 991682359 5:69151746-69151768 CCAGGGGACACCCCAAGCCCAGT No data
Right 991682366 5:69151791-69151813 CTGTATATATAGATTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991682366 Original CRISPR CTGTATATATAGATTAGGCC AGG Intergenic
No off target data available for this crispr