ID: 991682745

View in Genome Browser
Species Human (GRCh38)
Location 5:69154752-69154774
Sequence CAGTGTGGCTAGAGTATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991682745_991682749 25 Left 991682745 5:69154752-69154774 CCCTCTATACTCTAGCCACACTG No data
Right 991682749 5:69154800-69154822 TTCTATCTTTGTGTTTTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991682745 Original CRISPR CAGTGTGGCTAGAGTATAGA GGG (reversed) Intergenic
No off target data available for this crispr