ID: 991682749

View in Genome Browser
Species Human (GRCh38)
Location 5:69154800-69154822
Sequence TTCTATCTTTGTGTTTTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991682745_991682749 25 Left 991682745 5:69154752-69154774 CCCTCTATACTCTAGCCACACTG No data
Right 991682749 5:69154800-69154822 TTCTATCTTTGTGTTTTTCACGG No data
991682748_991682749 10 Left 991682748 5:69154767-69154789 CCACACTGGCTTTTCTGAATATG No data
Right 991682749 5:69154800-69154822 TTCTATCTTTGTGTTTTTCACGG No data
991682746_991682749 24 Left 991682746 5:69154753-69154775 CCTCTATACTCTAGCCACACTGG No data
Right 991682749 5:69154800-69154822 TTCTATCTTTGTGTTTTTCACGG No data
991682744_991682749 26 Left 991682744 5:69154751-69154773 CCCCTCTATACTCTAGCCACACT No data
Right 991682749 5:69154800-69154822 TTCTATCTTTGTGTTTTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991682749 Original CRISPR TTCTATCTTTGTGTTTTTCA CGG Intergenic
No off target data available for this crispr