ID: 991683446

View in Genome Browser
Species Human (GRCh38)
Location 5:69160820-69160842
Sequence TACCCCACCGTGCCTCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991683444_991683446 15 Left 991683444 5:69160782-69160804 CCGTGCAGGAAAAAAAAAAAAAA 0: 9
1: 57
2: 662
3: 6104
4: 47367
Right 991683446 5:69160820-69160842 TACCCCACCGTGCCTCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991683446 Original CRISPR TACCCCACCGTGCCTCCGCC TGG Intergenic
No off target data available for this crispr