ID: 991686897

View in Genome Browser
Species Human (GRCh38)
Location 5:69189720-69189742
Sequence GCTGCACGCCGCCTGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991686897_991686907 30 Left 991686897 5:69189720-69189742 CCGGCGCCCAGGCGGCGTGCAGC 0: 1
1: 0
2: 1
3: 9
4: 185
Right 991686907 5:69189773-69189795 TTCCCTTTGGCCTCCTCAGCCGG 0: 1
1: 0
2: 2
3: 31
4: 283
991686897_991686905 17 Left 991686897 5:69189720-69189742 CCGGCGCCCAGGCGGCGTGCAGC 0: 1
1: 0
2: 1
3: 9
4: 185
Right 991686905 5:69189760-69189782 GCTCCTCAGGTTGTTCCCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 160
991686897_991686901 4 Left 991686897 5:69189720-69189742 CCGGCGCCCAGGCGGCGTGCAGC 0: 1
1: 0
2: 1
3: 9
4: 185
Right 991686901 5:69189747-69189769 ACCGCATGACCCTGCTCCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991686897 Original CRISPR GCTGCACGCCGCCTGGGCGC CGG (reversed) Exonic
900364792 1:2306716-2306738 GCTGCCCGCAGCCTCGGGGCGGG - Exonic
900406923 1:2496816-2496838 GCTGGACGCCGCTGTGGCGCCGG - Exonic
900518081 1:3092662-3092684 GCTGGATGGCGCCTGGGTGCGGG + Intronic
901513580 1:9730595-9730617 GCTGCTCTCCGACTCGGCGCTGG + Exonic
903016856 1:20367003-20367025 GTCGCAGGCCGCCGGGGCGCGGG - Intergenic
903226084 1:21894855-21894877 GCTGCAGGATGCCTGGGAGCTGG - Intronic
905139012 1:35826105-35826127 GCTGCACGTTGCCTGTGCTCTGG + Intronic
905182645 1:36176448-36176470 GCTGCACGGCGTCAGGGGGCTGG - Exonic
905314346 1:37072046-37072068 GCTGCAGGCAGCCTGGCTGCTGG - Intergenic
906322744 1:44827108-44827130 GCTGCAGGCCTCCTGGGCCCAGG - Intronic
908270503 1:62417117-62417139 ACTGCACTCAGCCTGGGCGACGG + Intergenic
912363469 1:109113863-109113885 GGTGCGCGCGGCGTGGGCGCGGG - Intronic
914386115 1:147172071-147172093 GCTGCACGCTCCGAGGGCGCAGG - Exonic
914845776 1:151282765-151282787 CCTGCACCCCGACTGGGTGCGGG + Intronic
916588270 1:166166532-166166554 CCTGCCCTCCGCCCGGGCGCTGG - Exonic
916890039 1:169105895-169105917 GGTCCACCCCTCCTGGGCGCTGG - Intronic
919847423 1:201650517-201650539 GCTGCCCGCCCGCTGGGGGCTGG + Intronic
920129807 1:203723492-203723514 GCTGCACTCCCCCTGGGGGAGGG - Intronic
920234599 1:204494490-204494512 GCCGCACGCCGCCTGCTCCCGGG + Intronic
920332788 1:205222925-205222947 GCTGCATGCGGCCTGTGGGCTGG + Intergenic
921218903 1:212959647-212959669 GCTGCCCCCCGCCTGGGCATCGG - Intronic
1063458518 10:6201596-6201618 CCCGGTCGCCGCCTGGGCGCGGG + Intronic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1065069016 10:22003302-22003324 GCTGCTGGCCGCCGTGGCGCCGG - Exonic
1067079737 10:43206180-43206202 GCTGCAGGCTGCCTGGGAGGAGG - Intronic
1067407454 10:46036132-46036154 GCTCCACGCTGCCCGGGCCCAGG - Intronic
1067682647 10:48450481-48450503 CCTGCACACCGACTGGGCCCTGG - Exonic
1073138032 10:101230301-101230323 GCTGCGCTCCGCCCGGGCCCCGG + Intergenic
1074055997 10:109923358-109923380 GCTGCACGCTGCCCGGACGCCGG + Intronic
1074826205 10:117217103-117217125 GCTGCACCCCGTCTGTCCGCAGG - Intergenic
1076853300 10:133103482-133103504 GGTGCAGGCCGCCGGGGCGGCGG - Intronic
1077532111 11:3102146-3102168 GCTGCAACCGGCCTGGGTGCTGG - Intronic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1079296681 11:19241181-19241203 GCTGCGCGGGGCCTGAGCGCGGG + Intronic
1080870078 11:36229267-36229289 GCTGCTGGCTGCCTGGGAGCTGG - Exonic
1080923355 11:36731003-36731025 GCTGCAGGCTGCTTGGGAGCTGG + Intergenic
1081716275 11:45252597-45252619 GCTGCACACCACCTGGGAGGAGG - Exonic
1083741303 11:64712930-64712952 GCCGCCCGGTGCCTGGGCGCGGG - Intronic
1083872623 11:65498395-65498417 GCTGCTCCCCGCCTGAGCCCCGG - Intergenic
1084858731 11:72004732-72004754 GCTGCATGCTGGCTCGGCGCAGG + Exonic
1094375426 12:29783810-29783832 GCCGCGCGCCGCCGGGGCCCCGG - Exonic
1097537386 12:60889335-60889357 GCTGCAGGCTGCATGGGAGCTGG - Intergenic
1098262668 12:68686857-68686879 GGTGCACGCCCGGTGGGCGCAGG - Exonic
1103534730 12:121626720-121626742 GGAGCACGCCGCCGAGGCGCGGG - Exonic
1104965993 12:132509078-132509100 GCAGCATGCCTCCTGGGCCCGGG + Intronic
1106172992 13:27304803-27304825 AATGCACTCCCCCTGGGCGCAGG - Intergenic
1108122176 13:47201227-47201249 ACTGCACTCCACCTGGGCGACGG - Intergenic
1108503197 13:51086267-51086289 ACTGCACACAGCCTGGGCGATGG + Intergenic
1109218315 13:59615374-59615396 GCTGCACAGAGCCTGGGTGCAGG + Intergenic
1113231207 13:108215550-108215572 GCTGCTCGCCGCGCAGGCGCAGG + Intronic
1113536125 13:111067479-111067501 GCAGCACGGAGCCTGGCCGCGGG + Intergenic
1113609491 13:111633144-111633166 GCTCCAGGCCTCCTGGGCACTGG + Intronic
1113747504 13:112755223-112755245 GCTGCACGTGGACTGGGGGCGGG + Intronic
1114558838 14:23577334-23577356 GCTGTACTCGCCCTGGGCGCCGG + Exonic
1115398161 14:32933021-32933043 GCGGGACGCCGCCAGGGCGAAGG + Intergenic
1122542804 14:102507382-102507404 GCTGCACGTGGCCTGTGAGCTGG - Exonic
1123909246 15:24950583-24950605 ACTGCACTCCGCCTGGGTGATGG - Intronic
1123998302 15:25733985-25734007 GCTGCACTCCCCCCGGGTGCCGG - Intronic
1128103960 15:65029397-65029419 GCTGCACGCCGCCAGGTACCCGG - Exonic
1131118167 15:89806837-89806859 GCTGCAGGCGGCCTGGGATCAGG + Intronic
1132352761 15:101150094-101150116 GTTGCACGCCCGCTGGGCACAGG - Intergenic
1132641920 16:981942-981964 GCTGCAGGGCGGCTGGGAGCGGG - Exonic
1137300564 16:47144115-47144137 GCTGGGAGCCGGCTGGGCGCGGG + Intergenic
1137926597 16:52546978-52547000 GCTGCGCGCGGGCCGGGCGCCGG + Exonic
1139451092 16:67028892-67028914 GCTCCACGCCGAGTGGCCGCGGG + Intergenic
1140033883 16:71358733-71358755 GCTCCGCGCCGGCTGGGCTCTGG - Exonic
1141799963 16:86300845-86300867 GCTGCACTCAGCCTGGACGTCGG - Intergenic
1142338951 16:89508358-89508380 GCTACACGGCGCCTGCGCGGCGG - Intronic
1142411359 16:89918745-89918767 CCTGCACGCCGCCTGGTGGCAGG + Exonic
1143067792 17:4263659-4263681 GCTGCACGCAGCACCGGCGCGGG + Exonic
1143091049 17:4449354-4449376 GCTGCACGGCTCCTGGAAGCAGG - Exonic
1143483438 17:7239564-7239586 GGTGCACTGCGCCTCGGCGCCGG - Intronic
1143615168 17:8045342-8045364 GCGGCCCGCAGCCTGGGCTCTGG - Exonic
1144703053 17:17351097-17351119 GCTGCTCTCCCCCTGGGCTCAGG - Intergenic
1145881771 17:28357491-28357513 GCGGAACGCCGCCCGGCCGCGGG - Exonic
1146371165 17:32266227-32266249 GATGCGCTCCGCCTCGGCGCAGG - Exonic
1146943977 17:36861857-36861879 GCTGCAGGCAGACTGGGAGCTGG + Intergenic
1147179435 17:38674870-38674892 CCTCCCCGCCGCCTGGGCCCGGG - Exonic
1148792043 17:50178591-50178613 GCTGCACGCTGCCCCGGAGCAGG + Intergenic
1150048807 17:61938759-61938781 ACTGCACTCCGCCTGGGCGATGG - Intergenic
1151555138 17:74842917-74842939 GCTGCACGCGGCCTGGGCCCGGG - Exonic
1152071164 17:78134440-78134462 GCGGCAGGCCGTCTGGGCCCGGG - Exonic
1152625752 17:81387220-81387242 CCAGCACGCTGCCTGGGCTCTGG + Intergenic
1153255690 18:3168324-3168346 ATTGCACTCCGCCTGGGCGACGG - Intronic
1153864539 18:9251754-9251776 ACTGCACTCCACCTGGGCGACGG + Intronic
1154070671 18:11149174-11149196 GCCGCGGGCCGCCTGGGGGCTGG - Intergenic
1157496286 18:48159854-48159876 GCTGGAGGCCCCCTGGGCTCTGG - Intronic
1157753103 18:50195265-50195287 GCTGGACGCCGCGCGCGCGCAGG + Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1161055423 19:2188504-2188526 GGTGCAGGCCCCCTCGGCGCTGG + Intronic
1161452534 19:4354455-4354477 GCTGCCCACCGACTGGGCTCCGG - Intronic
1161689015 19:5720042-5720064 GCTGGCCGCCGCCGGGGGGCGGG - Exonic
1162031697 19:7920373-7920395 GCCGCTCGCCGCCTGGGAGGTGG - Exonic
1162176291 19:8832558-8832580 GCCGCACGAGGCCTGGGGGCGGG + Intronic
1162798097 19:13096811-13096833 GCTGCAGGCCAGCTGGGCCCGGG + Intronic
1163552546 19:17973839-17973861 GCTGCAGGCCGCCCGGGGCCCGG - Exonic
1166959717 19:46490100-46490122 GCTGCAAGCCCACGGGGCGCTGG + Intronic
1167728180 19:51233412-51233434 GCTGCATGGAGCCTGGGCCCAGG - Intronic
926194943 2:10757675-10757697 ACTGCATGCCGCCTGGAAGCTGG + Intronic
927642119 2:24852123-24852145 GCTCCATGCCACCTGGGCGTGGG + Intronic
927843692 2:26460768-26460790 CCAGCACGCAGCCTGGACGCTGG - Intronic
928159651 2:28910733-28910755 GCTGCACTCCACCTGGGTGACGG - Intronic
933707695 2:85304119-85304141 GGAGCACGCTGCCTGGGCGGGGG - Intronic
935145438 2:100392120-100392142 GCTGGAGGCTACCTGGGCGCTGG + Exonic
936458763 2:112695413-112695435 GCTGCACTCGGCCTGGGCCACGG - Intergenic
937325236 2:120986294-120986316 GCTGCAGGACGACTGGGCCCCGG - Exonic
942117531 2:172742858-172742880 CCTGCATGCAGCCTGGGAGCTGG + Intronic
942462597 2:176178578-176178600 GCAGCACAGGGCCTGGGCGCAGG + Intergenic
947741649 2:232487527-232487549 GCCGCACGGCGCCGGGGCTCGGG - Intronic
948624001 2:239256469-239256491 GCTGGAACCCGCCTCGGCGCTGG - Intronic
948729238 2:239952755-239952777 GCTGCACCCCTCCGGGGCCCTGG - Intronic
948761048 2:240191212-240191234 GCTGAGCACCGCCTTGGCGCTGG + Intergenic
948767943 2:240233169-240233191 GCAGCACGCTGACTGGGCGCCGG - Intergenic
948768519 2:240235552-240235574 GCTGCAACCTGCCTGGGAGCAGG + Intergenic
1171394637 20:24824113-24824135 GCTGCTCCCCGCCTGTGGGCAGG - Intergenic
1171533498 20:25867175-25867197 GCTATACGCTGCCTGGGCTCCGG - Intronic
1175788274 20:61725419-61725441 GCTTCGCGCTGCCTGGGAGCAGG + Intronic
1175944977 20:62554475-62554497 GCGGCAGGCTGCCTGGGCGTTGG + Intronic
1176040744 20:63064559-63064581 GCTGGAGGCCGCCCGGGCTCTGG + Intergenic
1178584021 21:33858100-33858122 GCTGCCCTCCTCCTGGGCTCTGG - Intronic
1179958821 21:44756982-44757004 GCTGAACGCCGTCTGTGCCCTGG + Intergenic
1180657820 22:17438537-17438559 GCTGCAGGCGGCCTGCGGGCAGG - Intronic
1183244755 22:36685300-36685322 GATGGAAGCTGCCTGGGCGCGGG - Intronic
1183577399 22:38700765-38700787 GCTGCGAGCCGGGTGGGCGCGGG - Intronic
1183601306 22:38842206-38842228 GCTGCACTCCACCTGGGTGGAGG + Intronic
1185040479 22:48501410-48501432 GCAGCACACCGCCCGGGTGCTGG - Intronic
1185150053 22:49159182-49159204 GCTGCTCCCCGTCTGGGCCCCGG - Intergenic
950771167 3:15312517-15312539 GCTGCACGCCACCTGCCCTCAGG + Intronic
952764874 3:36945018-36945040 GCTGCACACCGCCCGGACGCCGG - Exonic
956678225 3:71754478-71754500 GGTGTGCGCCGCCTGGGCGCTGG + Exonic
958905414 3:99936660-99936682 GCTTCAAGCGGGCTGGGCGCAGG - Intronic
960019362 3:112932261-112932283 GCTGCATGGAGCCTGGGCTCAGG + Intronic
960466001 3:117997212-117997234 GCTGCACAGCGTCTGGGTGCTGG - Intergenic
960756432 3:121019059-121019081 GCTGCAGGCTGCCTGGGAACTGG + Intronic
962250844 3:133835091-133835113 GCTGTTCGCTGCCTTGGCGCCGG - Intronic
963067350 3:141274240-141274262 GCTGCAGGCCGCCTCTGCCCTGG - Intronic
965882076 3:173397939-173397961 ACTGCACTCCGCCCGGGCTCTGG - Intronic
968372724 4:10852-10874 GACGGACGCCGCCGGGGCGCAGG + Intergenic
973907360 4:55546032-55546054 GCGGCACGCGGGCCGGGCGCCGG + Intronic
980009785 4:127581911-127581933 GCTGCATGGAGCCTGGGCCCAGG - Intergenic
984122138 4:175758814-175758836 GCTGACCGCCTCCTGGGCACTGG - Intronic
985629906 5:1008905-1008927 GCTCCACGCCGCGCGGGGGCCGG - Exonic
987339071 5:16923322-16923344 ACTGCACTCCACCTGGGCGACGG - Intronic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
992343040 5:75845939-75845961 ACTGCACTCCACCTGGGCGACGG - Intergenic
992945297 5:81803571-81803593 GCTGCATGGAGCCTGGGCCCAGG + Intergenic
993900213 5:93579765-93579787 GCTGCCAGCCGGCTGGGGGCGGG - Intergenic
1001381365 5:171308666-171308688 GCTTCGCGCTGCCTGCGCGCGGG - Exonic
1002184300 5:177447079-177447101 GCTGCTCGCGGCCCGGGCGGGGG - Intronic
1002409150 5:179060524-179060546 GCTGCACGCCGCCCACTCGCTGG - Exonic
1003324885 6:5084446-5084468 GGTGCGTGCCGCGTGGGCGCCGG + Intergenic
1006706333 6:36024471-36024493 GCTGGGAGACGCCTGGGCGCCGG - Intronic
1007596227 6:43052934-43052956 GCTGCACGCTGGGTGGGGGCAGG + Intronic
1010794800 6:80106638-80106660 GCCGCACGCCGCCTGCGGGGAGG - Exonic
1014681668 6:124438648-124438670 GCTGCACGCTGCATGAGAGCAGG - Intronic
1016043695 6:139459409-139459431 ACTGCACTCAGCCTGGGCGACGG - Intergenic
1019018805 6:168900626-168900648 GCTGCACTCCCCCTGGGGTCAGG - Intergenic
1019279572 7:193043-193065 CCTGCACGCGGCCCGGGCCCGGG + Exonic
1019726517 7:2605904-2605926 GCTGCCCGTGGCCTGGGCGATGG - Exonic
1020796799 7:12686830-12686852 CCCGCGCGCCGCCCGGGCGCCGG - Intergenic
1026000464 7:66556696-66556718 GCAGGACGCCGCCTCGGCGGGGG - Intergenic
1028261657 7:88674047-88674069 ACTGCAGGCTGCCTGGGAGCTGG + Intergenic
1029649284 7:101879789-101879811 GCTGGACGCTGCCTTGGGGCAGG - Intronic
1033651230 7:143345589-143345611 GCTGCGCGCAGCCTGCGCTCAGG - Exonic
1034347736 7:150397563-150397585 GCAGGGCGCAGCCTGGGCGCCGG - Exonic
1034691425 7:153017401-153017423 GCTGCATGCAGCCCGGCCGCTGG - Intergenic
1035269331 7:157710709-157710731 ACTGCCTGCCGCCTGGGCACAGG + Intronic
1039463104 8:37762492-37762514 GATGGCCGCCGCCTGGGGGCGGG + Intergenic
1040981808 8:53251862-53251884 GCGGCACACCGCCTGGTCCCCGG + Intergenic
1047024506 8:120811594-120811616 GCTGCGCGCCGCCCGCGCCCGGG + Exonic
1048136401 8:131750555-131750577 GCTGCATGCAGCCTGTGGGCTGG - Intergenic
1049024517 8:139979519-139979541 GCTGGACGCAGCCTGGGCATTGG - Intronic
1049423920 8:142528883-142528905 GCTGCACTCCACCTGTGCCCAGG - Intronic
1049599273 8:143499457-143499479 ACTGAACACCGGCTGGGCGCAGG - Intronic
1049621170 8:143598932-143598954 GCTGCAGGCAGCTTCGGCGCAGG - Exonic
1050357060 9:4793242-4793264 GCGGCGCGCGGCGTGGGCGCGGG + Intronic
1053784575 9:41645044-41645066 GCTGTATGCTGCCTGGGCTCCGG + Intergenic
1054870477 9:70043962-70043984 GCTGCTCAGCGCCGGGGCGCTGG + Exonic
1058512872 9:105738753-105738775 ACTGCACTCAGCCTGGGCGACGG - Intronic
1058976392 9:110128783-110128805 TCTGCTCTCCGCCTGGGCTCAGG + Intronic
1060648660 9:125305408-125305430 ACTGCACTCCGCCTGGGCGACGG - Intronic
1060826163 9:126689228-126689250 TCTGCATGCTGCCTGGGCACTGG - Intronic
1061244068 9:129392276-129392298 GCTGCAGGAGGCCTGGGCCCTGG - Intergenic
1061666105 9:132161867-132161889 GCTGCCCGGCGCCCGAGCGCGGG + Intronic
1061920693 9:133780749-133780771 GCTGCACGGGGCCTTGGCGTCGG - Intronic
1061961901 9:133992799-133992821 GCTCCACGGCTCCGGGGCGCTGG + Intergenic
1062022605 9:134326535-134326557 GCTCCCCGCCGCCCGGGCCCGGG + Intronic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062266957 9:135690908-135690930 GCTGCACCCCAACTGGGAGCCGG - Intergenic
1185460593 X:331292-331314 TCTACACGGCGCCAGGGCGCAGG + Intergenic
1185746683 X:2579103-2579125 ACTGCACCCAGCCTGGGCGACGG - Intergenic
1186496518 X:10015760-10015782 GCTGCCCGCCGGCTGGGAGGAGG + Exonic
1192746536 X:73944261-73944283 AGTGCACGACGGCTGGGCGCCGG + Intergenic
1193937092 X:87636661-87636683 GCTGCAGGCTGCATGGGAGCTGG + Intronic
1195237065 X:102911165-102911187 GCTGCAGGCTGCATGGGAGCAGG + Intergenic
1196519395 X:116655124-116655146 GCTACAGGCCGCGTGGGAGCTGG - Intergenic