ID: 991689652

View in Genome Browser
Species Human (GRCh38)
Location 5:69213831-69213853
Sequence GGAGAAATAGGCAAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3569
Summary {0: 14, 1: 43, 2: 94, 3: 375, 4: 3043}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991689652_991689656 -10 Left 991689652 5:69213831-69213853 CCTTTCTTCTTGCCTATTTCTCC 0: 14
1: 43
2: 94
3: 375
4: 3043
Right 991689656 5:69213844-69213866 CTATTTCTCCCTCTTGGAATGGG No data
991689652_991689661 28 Left 991689652 5:69213831-69213853 CCTTTCTTCTTGCCTATTTCTCC 0: 14
1: 43
2: 94
3: 375
4: 3043
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991689652 Original CRISPR GGAGAAATAGGCAAGAAGAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr