ID: 991689654

View in Genome Browser
Species Human (GRCh38)
Location 5:69213843-69213865
Sequence CCATTCCAAGAGGGAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991689654_991689661 16 Left 991689654 5:69213843-69213865 CCTATTTCTCCCTCTTGGAATGG No data
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991689654 Original CRISPR CCATTCCAAGAGGGAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr