ID: 991689658

View in Genome Browser
Species Human (GRCh38)
Location 5:69213853-69213875
Sequence ACTGACATTCCCATTCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991689658_991689661 6 Left 991689658 5:69213853-69213875 CCTCTTGGAATGGGAATGTCAGT No data
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991689658 Original CRISPR ACTGACATTCCCATTCCAAG AGG (reversed) Intergenic
No off target data available for this crispr