ID: 991689661

View in Genome Browser
Species Human (GRCh38)
Location 5:69213882-69213904
Sequence CCTGACCCATCATTGTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991689658_991689661 6 Left 991689658 5:69213853-69213875 CCTCTTGGAATGGGAATGTCAGT No data
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data
991689652_991689661 28 Left 991689652 5:69213831-69213853 CCTTTCTTCTTGCCTATTTCTCC 0: 14
1: 43
2: 94
3: 375
4: 3043
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data
991689657_991689661 7 Left 991689657 5:69213852-69213874 CCCTCTTGGAATGGGAATGTCAG No data
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data
991689654_991689661 16 Left 991689654 5:69213843-69213865 CCTATTTCTCCCTCTTGGAATGG No data
Right 991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991689661 Original CRISPR CCTGACCCATCATTGTGTTT TGG Intergenic
No off target data available for this crispr