ID: 991705148

View in Genome Browser
Species Human (GRCh38)
Location 5:69350411-69350433
Sequence GGTATATTGTGACCAGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991705140_991705148 18 Left 991705140 5:69350370-69350392 CCCAACTGGTGGTCTAGGACTGA 0: 1
1: 0
2: 1
3: 8
4: 69
Right 991705148 5:69350411-69350433 GGTATATTGTGACCAGACCCCGG No data
991705141_991705148 17 Left 991705141 5:69350371-69350393 CCAACTGGTGGTCTAGGACTGAA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 991705148 5:69350411-69350433 GGTATATTGTGACCAGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991705148 Original CRISPR GGTATATTGTGACCAGACCC CGG Intergenic
No off target data available for this crispr