ID: 991711333

View in Genome Browser
Species Human (GRCh38)
Location 5:69411784-69411806
Sequence TGCCATAATCTTAGGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991711333 Original CRISPR TGCCATAATCTTAGGGGGTT GGG (reversed) Intronic
901291372 1:8126815-8126837 TGCCATAGTATTAGGAGGTGGGG + Intergenic
910035538 1:82783427-82783449 AGGCATAATTTTAGAGGGTTTGG + Intergenic
911659619 1:100486628-100486650 TGCCATCACCTTGTGGGGTTGGG + Intronic
911818267 1:102382764-102382786 TGCCATCATATTAGGGGTTAGGG + Intergenic
916213948 1:162380343-162380365 TGCCATATTCTAAGGGCCTTTGG - Intronic
921801186 1:219404233-219404255 TGCCATCACATTAAGGGGTTGGG + Intergenic
923910700 1:238439695-238439717 TGCCCTGATCTTATGGGATTAGG - Intergenic
1063910904 10:10829539-10829561 TGCCATAATTTTATGGAATTTGG + Intergenic
1066459542 10:35601138-35601160 TGCCATCATTCTAGGGGGTAGGG + Intergenic
1067184665 10:44016353-44016375 TGCAAGAATCTCAGGGGGTAGGG + Intergenic
1067498612 10:46781725-46781747 TCCCAAAGTCTTAGAGGGTTAGG + Intergenic
1067596032 10:47558679-47558701 TCCCAAAGTCTTAGAGGGTTAGG - Intergenic
1071924968 10:90395593-90395615 TACCATAATATTAGGGGTTAGGG + Intergenic
1074836448 10:117300669-117300691 TACAATCATGTTAGGGGGTTGGG - Intronic
1082801746 11:57419947-57419969 TCCCATAAGCTTTGGAGGTTTGG - Intronic
1084481730 11:69425308-69425330 TGTCTTTATCTTAGGGGTTTTGG + Intergenic
1084811080 11:71611932-71611954 TTCCATACTCTTGGGGGTTTTGG - Intergenic
1087288270 11:96290872-96290894 TGCCATAGTCTTTGGCTGTTGGG + Intronic
1088711546 11:112513144-112513166 TCCCTTAATCTTAGGGGCTAGGG - Intergenic
1089496852 11:118912328-118912350 TGCCTCCCTCTTAGGGGGTTAGG + Intronic
1090613648 11:128494918-128494940 TATCATAATCTGATGGGGTTGGG - Intronic
1090853061 11:130587418-130587440 TGCCACAAGCTTAGTGGCTTGGG + Intergenic
1100004750 12:89881373-89881395 TGCAACAATCTTAAGGGGTGAGG + Intergenic
1110491756 13:76118052-76118074 TACCATAATCTCAGGGGTTCAGG - Intergenic
1112829743 13:103434465-103434487 TGCCACATTATTAGGAGGTTTGG - Intergenic
1121383073 14:93491191-93491213 TACCATCACATTAGGGGGTTTGG + Intronic
1121402486 14:93692455-93692477 TGCTATAATGTCAGAGGGTTAGG + Intronic
1125454567 15:39844272-39844294 ATTCATAATCTAAGGGGGTTTGG + Intronic
1126556617 15:49995015-49995037 TGTCACATTCTTAGTGGGTTGGG - Intronic
1130996333 15:88906567-88906589 TGCTAGAACCTTAGGGGGTATGG + Intronic
1140640396 16:76965147-76965169 TGACATAATCTCAAGGAGTTGGG + Intergenic
1140754947 16:78058675-78058697 TTACATACTCTTAGGGGTTTTGG + Intronic
1143053504 17:4145218-4145240 TGTCATTATCTTAGGGGAATTGG + Intronic
1146471765 17:33130597-33130619 TCCCAGACTCTTGGGGGGTTGGG - Intronic
1146561039 17:33870978-33871000 TGCCAGCATCTCAGGGGGTGGGG - Intronic
1153704748 18:7733951-7733973 TTCCCTAATCCTAGGGGATTTGG + Intronic
927759283 2:25737419-25737441 TCCAGTAATGTTAGGGGGTTAGG + Intronic
932190222 2:69735003-69735025 TTCCATAATCTTGTGGAGTTGGG - Intronic
935817047 2:106856241-106856263 TGCCATTATCCTAGGCAGTTAGG - Intronic
940540700 2:155012064-155012086 TGCCATATTTTTAGGTGTTTGGG + Intergenic
943976259 2:194482541-194482563 TGCCACAAACTTAGTGGCTTAGG - Intergenic
946145418 2:217726909-217726931 TACCATCATCTTGGGGGGTTAGG + Intronic
948228378 2:236331202-236331224 TGACAAAATCTTTGGGGTTTTGG - Intronic
1170143035 20:13143987-13144009 TGACATGCTCTGAGGGGGTTAGG - Intronic
1170996679 20:21367305-21367327 TGCCATAATGTTAATGAGTTAGG + Intronic
1171022581 20:21599810-21599832 TGCCCTAATCTGAGGGCTTTTGG + Intergenic
1171219476 20:23381999-23382021 TGCCTTAGTGTCAGGGGGTTGGG - Intronic
1172323075 20:34012190-34012212 TGCCATAGCCTGAGGTGGTTGGG + Intronic
951911521 3:27755254-27755276 TACCATCACCTTGGGGGGTTAGG - Intergenic
954897615 3:53990123-53990145 TGCCAAATTCTTACGGGCTTTGG + Intergenic
956495469 3:69821379-69821401 TGACTCAAGCTTAGGGGGTTGGG - Intronic
956689577 3:71863534-71863556 TGCCATCACCTTGGGGGGTTAGG + Intergenic
959995862 3:112679492-112679514 TGCCATCACCTTCGGGGGTTTGG + Intergenic
960203764 3:114870205-114870227 TGGAATAATCTTTGGGGATTAGG - Intronic
961497060 3:127301276-127301298 TCCCATCATCGTAGGGGTTTTGG + Intergenic
962210002 3:133469743-133469765 TGCCATAATGTCAGGGACTTAGG + Intronic
971968642 4:33594036-33594058 TGCCATAAATTTGGGGGTTTGGG - Intergenic
972498996 4:39660248-39660270 TGGCATCATCTTCGTGGGTTTGG - Intergenic
975975979 4:80097218-80097240 TGCCATCACCTTGGGGGGTTGGG + Intronic
976698866 4:87947474-87947496 TGCCATCATCTTAGTCCGTTTGG + Intergenic
981272067 4:142856958-142856980 TGTGATAATCTTAGGAGGTGGGG - Intergenic
983837413 4:172408074-172408096 TGCCACAACCTTTGGGGATTCGG + Intronic
983875145 4:172866666-172866688 TGGCAGAATCTTAGGGTGTGAGG - Intronic
990505736 5:56442805-56442827 TACCATCATATTAGGGGTTTGGG + Intergenic
991711333 5:69411784-69411806 TGCCATAATCTTAGGGGGTTGGG - Intronic
996049061 5:118910995-118911017 TACCATCACCTTCGGGGGTTAGG + Intronic
999652260 5:153779072-153779094 TGCCATAAGTTTAGAGGGTGGGG + Intronic
1005804780 6:29463957-29463979 TGCCATCATCTTGGTGGTTTAGG + Exonic
1006736934 6:36280371-36280393 AGCAATAATCCTAGGGTGTTTGG - Intronic
1007304294 6:40892189-40892211 TGCCCTAATTAAAGGGGGTTGGG - Intergenic
1007737926 6:43993363-43993385 TGCCATAGACTCAGGGGCTTAGG + Intergenic
1010496601 6:76539994-76540016 TACCGTCACCTTAGGGGGTTAGG + Intergenic
1017994903 6:159523500-159523522 TGCCATGACCTTAAGGGGGTGGG - Intergenic
1018948378 6:168362834-168362856 TGCTATAAGCTTTGGGGGTAGGG - Intergenic
1019731088 7:2630077-2630099 AGCCTTGGTCTTAGGGGGTTGGG + Intergenic
1020323503 7:6957273-6957295 TTCCATACTCTTGGGGGTTTTGG + Intergenic
1020521765 7:9198105-9198127 TGCTATAATATTTGGGGATTGGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1031307206 7:120144582-120144604 TGTCATAATCTTAGAGGGAGTGG - Intergenic
1031531433 7:122881614-122881636 TGCCATACTCTTAGGGAGATAGG - Intronic
1031667310 7:124500457-124500479 TTCCATATTCTTTGGGGTTTGGG - Intergenic
1036501401 8:9317861-9317883 TGCAATATTCTCAGGTGGTTGGG + Intergenic
1036817060 8:11910155-11910177 TTCCATACTCTTGGGGGTTTTGG + Intergenic
1036817400 8:11912466-11912488 TTCCATACTCTTGGGGGTTTTGG + Intergenic
1036995190 8:13647105-13647127 TGTAATAATATTAGGGGGTGGGG - Intergenic
1042378140 8:68079776-68079798 TCCAAGAATCTTAGGGGATTTGG + Intronic
1043939874 8:86185399-86185421 TGGCCTAATCTGAGGGGCTTAGG - Intergenic
1058560832 9:106227147-106227169 TGCAATAATCTTAAGAGGTGGGG + Intergenic
1189489247 X:41456914-41456936 TACCATCATCTTGGGGAGTTGGG - Intronic
1192252466 X:69423989-69424011 TGTCATCATCTTGGGGGTTTAGG - Intergenic
1193459001 X:81767683-81767705 TACCATCACCTTAGGGGTTTAGG + Intergenic
1195039405 X:101000510-101000532 TGCCATTATTTTGGGGGGTGTGG - Intergenic
1195332850 X:103819923-103819945 TGCCATAACCTTGGGGGGTTAGG - Intergenic
1197136888 X:123071799-123071821 TGCCATCATCTTTGGGTCTTTGG - Intergenic
1198381868 X:136091475-136091497 TGTCATCATCTTGGGGGTTTAGG + Intergenic