ID: 991713130

View in Genome Browser
Species Human (GRCh38)
Location 5:69427822-69427844
Sequence CCACTGCACCTGTTCTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991713130_991713137 21 Left 991713130 5:69427822-69427844 CCAATAGAGAACAGGTGCAGTGG 0: 1
1: 0
2: 3
3: 36
4: 248
Right 991713137 5:69427866-69427888 CTTTGGGAAGCCAAAGCAGGTGG 0: 85
1: 3099
2: 33282
3: 85532
4: 158412
991713130_991713133 5 Left 991713130 5:69427822-69427844 CCAATAGAGAACAGGTGCAGTGG 0: 1
1: 0
2: 3
3: 36
4: 248
Right 991713133 5:69427850-69427872 GCCTGTAATCCGAGCACTTTGGG 0: 582
1: 233618
2: 278681
3: 180060
4: 136485
991713130_991713132 4 Left 991713130 5:69427822-69427844 CCAATAGAGAACAGGTGCAGTGG 0: 1
1: 0
2: 3
3: 36
4: 248
Right 991713132 5:69427849-69427871 CGCCTGTAATCCGAGCACTTTGG 0: 291
1: 130499
2: 284220
3: 222170
4: 146546
991713130_991713136 18 Left 991713130 5:69427822-69427844 CCAATAGAGAACAGGTGCAGTGG 0: 1
1: 0
2: 3
3: 36
4: 248
Right 991713136 5:69427863-69427885 GCACTTTGGGAAGCCAAAGCAGG 0: 173
1: 6072
2: 73561
3: 190765
4: 233473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991713130 Original CRISPR CCACTGCACCTGTTCTCTAT TGG (reversed) Intronic
901109361 1:6783314-6783336 CCACTGCACCCGGCCTGTATCGG + Intergenic
901962188 1:12836173-12836195 CCTATGCACCAGGTCTCTATTGG - Intergenic
901968806 1:12890948-12890970 CCTATGCACCAGGTCTCTATTGG - Intronic
902016370 1:13310833-13310855 CCTATGCACCAGGTCTCTATTGG + Intronic
902901744 1:19521890-19521912 CCACTGCACCTGGCCTCTCATGG - Intergenic
907534241 1:55134758-55134780 TCACTCCCCCTGTTCTCTACTGG - Intronic
908720059 1:67116035-67116057 ACACTGTAACTGTTGTCTATAGG + Intronic
909215013 1:72875789-72875811 AAAATGCACATGTTCTCTATAGG - Intergenic
909579767 1:77221318-77221340 CCACTGCACCTGGCCTCTGATGG - Intergenic
910618046 1:89221629-89221651 TCACTGGACCTGTTCTCTAAGGG - Intergenic
911228563 1:95334649-95334671 TCACTGTACATGTGCTCTATTGG + Intergenic
912012650 1:104987673-104987695 CATCTGCACCTGTTCTCATTGGG - Intergenic
917354108 1:174107940-174107962 CCACCACACCTGGTCTCTTTAGG - Intergenic
921685196 1:218081996-218082018 CCACTGCACCCGGTCTGTTTGGG + Intergenic
923327920 1:232897208-232897230 TCACTTCACCTGTTCTCTCTCGG - Intergenic
923456559 1:234170052-234170074 CCACTGCACCTGGCCTCCAGGGG + Intronic
924742280 1:246801787-246801809 CCACTGCACCTGGTCTTGTTTGG - Intergenic
924779873 1:247137354-247137376 CCACTGCACCTGGCCTCCCTAGG - Intronic
1062784379 10:250340-250362 CCACTGCACCTGGCGTCTTTGGG - Intronic
1062883050 10:994044-994066 CCACTGCACCTGTCCAATAATGG + Intronic
1063111856 10:3045033-3045055 CCACTGCCCCTGGCCTCTATAGG + Intergenic
1063198160 10:3762318-3762340 CCACTCACCTTGTTCTCTATGGG - Intergenic
1065590185 10:27255984-27256006 CCACTGCACCTGGCCTGTTTTGG - Intergenic
1065827220 10:29583585-29583607 CCACTGCACCCGGCCTCCATGGG + Intronic
1065914186 10:30338834-30338856 CCACTGCACCTGGCCTGTCTTGG - Intronic
1066605076 10:37157658-37157680 CCACTGCACCTGGCCTGTATTGG + Intronic
1066605783 10:37168796-37168818 CCACTGCACCTGGCCTGTATTGG + Intronic
1066606566 10:37180588-37180610 CCACTGCACCTGGCCTGTATTGG + Intronic
1066607344 10:37192329-37192351 CCACTGCACCTGGCCTGTATTGG + Intronic
1070243863 10:74711557-74711579 CCACTGCTCTTTTTCACTATAGG - Intergenic
1071093244 10:81944977-81944999 CCACTGCCCCTGAGCTCTAATGG + Intronic
1072499488 10:95998826-95998848 CCACTGCACCTGGCCTCTGAAGG - Intronic
1075531812 10:123236271-123236293 CCACTGCACCTATTCAGCATTGG - Intergenic
1079264613 11:18918769-18918791 TCACTGCAACTTTTCTCTACTGG - Intergenic
1080506066 11:32915193-32915215 CCACTGCACCTGGCCTGTTTTGG + Intronic
1082847683 11:57739784-57739806 CCACTGCACCTATTGTCTGTAGG + Intronic
1083413536 11:62510329-62510351 CCACTGCGCCCGCCCTCTATTGG + Intronic
1083827851 11:65213302-65213324 CCACTGCACCTGGCCTATTTGGG + Intergenic
1086184458 11:83997445-83997467 CCACTGCACCTGGTCTTATTTGG - Intronic
1087393851 11:97571752-97571774 CCACTCCTCCTGTTTTCTCTTGG + Intergenic
1087747977 11:101971819-101971841 CCACGGCACCTGGCCGCTATTGG - Intronic
1091177456 11:133574670-133574692 CCCCTTCACCTGTTGTTTATAGG + Intergenic
1091763534 12:3103627-3103649 ACACTGCTCCTGTTGTCTCTTGG + Intronic
1093992791 12:25609384-25609406 CCAGAGCACCTCTTCTCTAAAGG - Intronic
1095266528 12:40165386-40165408 CCAATGCACTAGTTCTCTCTGGG - Intergenic
1096102098 12:48976010-48976032 CCACTACACCTTTTCCCTCTGGG + Intergenic
1096262948 12:50104270-50104292 CAGCTGCACCTGTTCACCATGGG + Intronic
1096453397 12:51765060-51765082 CCACTGCACCTGGCCAGTATAGG + Intronic
1099170299 12:79355963-79355985 CCATAGCACCTGTTATCTCTTGG - Intronic
1100322980 12:93514556-93514578 CCACTGCACCTGGCCATTATTGG + Exonic
1104448668 12:128852999-128853021 CCCCTGCTCCTGTTCCCTGTGGG + Intergenic
1106290788 13:28359821-28359843 CCACTGCACCTGGCCTCATTTGG - Intronic
1106591784 13:31104588-31104610 CCACTGCACCTGGCCTCTTCAGG + Intergenic
1108212971 13:48157004-48157026 CCACTGCACCTGGCCTTTAGGGG - Intergenic
1108299169 13:49056652-49056674 CCAGTTCACCTGTTTTCTACTGG + Intronic
1114038046 14:18647979-18648001 TCACTGCACCAGGTTTCTATGGG + Intergenic
1114120568 14:19667057-19667079 TCACTGCACCGGGTTTCTATGGG - Intergenic
1114448899 14:22811560-22811582 CCACTGCACCCGGCCTCTGTGGG - Intronic
1114870513 14:26650189-26650211 CTACTGCTCCTTTTCACTATAGG + Intergenic
1117512977 14:56471585-56471607 GCACTGCACCTGTTCTCTGGGGG + Intergenic
1117888450 14:60391253-60391275 CCACTGCGCCTGGCCTCTAATGG - Intergenic
1118661557 14:68019243-68019265 CCACTGCAGCGGTACTCTGTAGG - Intronic
1125011384 15:34879765-34879787 ACACTAAACCTGTTGTCTATTGG - Intronic
1125131042 15:36285471-36285493 CCTCTCCAACTCTTCTCTATGGG - Intergenic
1126413372 15:48394528-48394550 CCACTGGACCTGGGCTCAATGGG - Intergenic
1128011671 15:64303074-64303096 CCATTGCACCTGGCTTCTATGGG - Intronic
1128305567 15:66596753-66596775 CCACTGCACCTGGCCTCCTTAGG + Intronic
1129228209 15:74181996-74182018 CCATTGTCCCTTTTCTCTATGGG + Intronic
1130630870 15:85567993-85568015 CCACTGCGCCTGGTCTCTACTGG - Intronic
1130687068 15:86047950-86047972 CCACTGCACCTGGCCTCTATTGG - Intergenic
1132186094 15:99803105-99803127 CCACATCACCTGTTTTATATAGG - Intergenic
1132233355 15:100200855-100200877 GAACTGCACCTGCTCTCCATGGG + Intronic
1134037082 16:11039478-11039500 CCACTGCGCCTGTCCCCTCTTGG - Intronic
1134308058 16:13051261-13051283 CCCCTGCACATGCTCTCTCTTGG - Intronic
1135078541 16:19414623-19414645 CCACTGTGCCTGGTCTCTTTGGG - Intronic
1135484275 16:22850373-22850395 CCATTGCTCCAGTTATCTATTGG + Intronic
1136108435 16:28048547-28048569 CCACTGCACCTGGCCTATACTGG + Intronic
1136176142 16:28518288-28518310 CCACTGCACCCGGCCCCTATGGG - Intergenic
1136542995 16:30938921-30938943 CCACTGCGCCTGGCCACTATTGG + Intronic
1138376493 16:56567863-56567885 CCACTGCACCTGGCCTGGATTGG - Intronic
1139777962 16:69329148-69329170 CCACACCACCTGTTCTCCATTGG + Exonic
1144325716 17:14177881-14177903 CCACTGCATCTGTTCTCCTTAGG + Intronic
1144474590 17:15574769-15574791 CCACTGCATCTGTTCTCCTTAGG + Intronic
1145812891 17:27775170-27775192 CCACTGCACCTGGCCATTATAGG - Intronic
1146542379 17:33708613-33708635 CTACTACCTCTGTTCTCTATGGG + Intronic
1148176076 17:45566346-45566368 CCACTGCACCTGGCCTGTTTGGG + Intergenic
1150407307 17:64913314-64913336 CCACTGCACCTGGCCTATTTTGG + Intronic
1151299761 17:73215559-73215581 CCACTGCACCTGGCCACTAGGGG + Intronic
1153439731 18:5103075-5103097 ACACAGCACCTTTTCTTTATGGG + Intergenic
1155590159 18:27418852-27418874 TCACTGCTCTGGTTCTCTATGGG - Intergenic
1155990504 18:32274615-32274637 CCACTGCTCCTAGTCTATATGGG + Intronic
1157526653 18:48388112-48388134 CCACTGCACCTGGCCTCTGTAGG + Intronic
1157766566 18:50301998-50302020 GCACTGCACCTGTCGTCTCTGGG + Intergenic
1159834381 18:73319656-73319678 TCACTGCACGTGTCCTCTAATGG + Intergenic
1161518821 19:4712259-4712281 CCACTGCACCTGGGCTGTCTGGG - Intronic
1162071401 19:8154526-8154548 CCACTGCACCTGGCCCCTAGTGG + Intronic
1165039404 19:33058492-33058514 CCACTGCGCCTGGTGACTATTGG - Intronic
1165059990 19:33200516-33200538 CCACTGCACCCGGTCTCTTTTGG + Intronic
1165227217 19:34363532-34363554 CCACTGCGCCTGGCCTCTACGGG - Intronic
1166001598 19:39880802-39880824 CAAGTGCACCTTTTCTCTAAAGG - Intronic
1166004380 19:39897053-39897075 CAAGTGCACCTTTTCTCTAAAGG - Intronic
1166617047 19:44259783-44259805 CCACTGCACCTGGCCCCTCTTGG + Intronic
1167141670 19:47655563-47655585 CCACTGCACCTGTCCTAAACCGG - Intronic
1167423337 19:49416476-49416498 CCACTGCACCTGGCCTGTAATGG + Intronic
924998914 2:388257-388279 CCACTGCACGTGGTCTCCACTGG + Intergenic
925425139 2:3743080-3743102 CAGCTGCCCCTGTTCTCTTTTGG - Intronic
927613692 2:24567053-24567075 CCACTGCAGCTGCTCTAGATGGG + Intronic
929471767 2:42200919-42200941 CCACTTCCCCTGTTCTCCATGGG + Intronic
929565332 2:42980228-42980250 CCAGTGCCCCTGTTCTCAAGAGG - Intergenic
930572748 2:53107609-53107631 CCACTGCACCTGCCCACTAGAGG - Intergenic
932719218 2:74125267-74125289 CCACTGCACCTGGCCTCACTTGG + Intergenic
933883219 2:86692612-86692634 CCACTGCACCTGGCCTTGATTGG - Intronic
935212796 2:100953086-100953108 CCACTGCATCTGGCCTTTATAGG - Intronic
935511769 2:103984543-103984565 CCACTGCACCCGGCCTCTACTGG + Intergenic
936396405 2:112135163-112135185 CCACCGCACCTGGCCTCTGTTGG + Intergenic
936736100 2:115445514-115445536 CCTCTGCCCCAGTTCTCAATAGG - Intronic
941400049 2:165019816-165019838 CCACTGCACCTGGCCTATTTTGG - Intergenic
944324800 2:198391641-198391663 CCACTGCACCTGGCCTGGATTGG + Intronic
944450281 2:199835504-199835526 CCCATCCACCTATTCTCTATTGG - Intronic
944773002 2:202932932-202932954 CCACAGCACCAGTTCTCCAGGGG + Intronic
945100446 2:206258021-206258043 CCACTGCACCTGGTCCCCGTGGG + Intergenic
945876552 2:215284028-215284050 CCACTGCACCTGACCTGTTTGGG - Intergenic
947476444 2:230452461-230452483 CCACTGCACCTGGCCGCCATTGG + Intronic
947857337 2:233333081-233333103 CCACCGCACCTGGCCTATATGGG + Intronic
948508731 2:238448830-238448852 TCACTGCCCCTGGTCTCTCTAGG + Exonic
1169441329 20:5636202-5636224 CCACTGCACCCGGCCTCCATGGG + Intergenic
1170670724 20:18430525-18430547 CCACCGCACCTGGCCTCCATTGG - Intronic
1170687364 20:18581580-18581602 CCACTGCACCTGGCCTACATTGG + Intronic
1171415090 20:24972694-24972716 CCACTGCAGGTGTTCACTATAGG + Intronic
1172286136 20:33741690-33741712 CCACTGCACCTGGCCTGTAAGGG + Intronic
1173833807 20:46112097-46112119 CCACTGCACCTGACCTCAGTGGG + Intergenic
1177780497 21:25617691-25617713 CCACTCTACCTGTACTCTCTTGG - Intergenic
1179239350 21:39575245-39575267 CCCCTACACCTGTTCTACATGGG - Intronic
1179921361 21:44509393-44509415 CCTCTGCACCTGCTCTCCTTTGG - Intronic
1180462173 22:15575020-15575042 TCACTGCACCAGGTTTCTATGGG + Intergenic
1180900335 22:19367048-19367070 CCACTGCACCTGGCCTTTATTGG + Intronic
1182488846 22:30656262-30656284 CCACTGCACTTGGACTCTAAGGG + Intronic
949618564 3:5784252-5784274 CCACCGCACCCGTCCTTTATTGG - Intergenic
952862859 3:37829516-37829538 CCACTGCACCTGGCCTGGATAGG - Intergenic
954658116 3:52209965-52209987 CCACTGCACCTGGCCTCTTCTGG + Intronic
955050340 3:55404369-55404391 GCACTGCACCTGCTCTCAAAGGG - Intergenic
955971789 3:64444686-64444708 CAACTGCTCCTCTTCTGTATGGG + Intronic
959517626 3:107286882-107286904 CCACTGCACCTGGCCCCTATAGG + Intergenic
960811404 3:121630937-121630959 CCACTGCACCTGGCCTCCTTAGG - Intergenic
960927483 3:122809432-122809454 CCACTGCACCTGGCCTTAATAGG - Intronic
961855194 3:129863572-129863594 CCACTGCGCCTGGCCTCTCTGGG - Intronic
963467111 3:145697518-145697540 CCACTGCTCCTCTTCTCAGTAGG - Intergenic
965782715 3:172304607-172304629 CCACTGCACCTGGCCTCACTCGG - Intronic
966973074 3:185062944-185062966 CCACTGCACCTGGCCTCTTCTGG - Intergenic
969356639 4:6631584-6631606 CCACTGCACCTGACCTTTACTGG + Intergenic
971760553 4:30759227-30759249 CCACTGCGCCTGGCCTCTTTGGG + Intronic
971973957 4:33659404-33659426 CCACTGCGTCTGTCCTCTAGAGG - Intergenic
972410206 4:38786160-38786182 CCACTGCTCCAGGTCTCTAGAGG - Intergenic
977182037 4:93887204-93887226 CCACTGCGCCTGACCTCTAAAGG + Intergenic
977808501 4:101332181-101332203 CCACAGCAACTGTTGTATATAGG + Intronic
977949894 4:102958633-102958655 CCACTGCGCCTGGCCTCTCTGGG - Intronic
979736500 4:124092267-124092289 CCTCAGCACATGTTCTCTGTTGG + Intergenic
980794295 4:137660930-137660952 GCAATTCACCTGTTCTCCATAGG + Intergenic
981938792 4:150260176-150260198 CCACTCCAGCTGTCCTCTGTCGG - Intergenic
982407259 4:155034270-155034292 CCACTGCACCTGTCCTGTATTGG + Intergenic
982716771 4:158817107-158817129 CCACTGCACCTGACCTCTGTGGG + Intronic
982904323 4:161048806-161048828 CCAGGGCCCCTGTACTCTATGGG - Intergenic
984964761 4:185130018-185130040 CCACTGCGCCTGTCCTTTATTGG + Intergenic
986363041 5:7000582-7000604 CCACTGTACCTGTCTTCTCTGGG - Intergenic
986383168 5:7206691-7206713 CCACTGCACCTGGTCTAGGTTGG - Intergenic
986517209 5:8576184-8576206 CCACAGCACTTTTTCTCAATTGG - Intergenic
986765320 5:10920779-10920801 CCACTGCACCTTTTATACATGGG - Intergenic
987552797 5:19405603-19405625 CCACTGCACCTGGACAATATAGG + Intergenic
989400348 5:41001422-41001444 CCACTGCACCCGGCCTCTCTTGG - Intronic
991087954 5:62665623-62665645 CCCCTGCGCCTGGCCTCTATGGG + Intergenic
991713130 5:69427822-69427844 CCACTGCACCTGTTCTCTATTGG - Intronic
991779064 5:70114745-70114767 CCACTTCACCCCTTCCCTATGGG - Intergenic
991858356 5:70990218-70990240 CCACTTCACCCCTTCCCTATGGG - Intronic
991871513 5:71115100-71115122 CCACTTCACCCCTTCCCTATGGG - Intergenic
992300796 5:75378066-75378088 CCACTGCACCTGGCCACTTTTGG + Intronic
993466749 5:88256986-88257008 CCACTGCACCTGGTCTTAAAAGG - Intronic
993834566 5:92801896-92801918 CTACAGCACCTTTTTTCTATGGG - Intergenic
995143570 5:108761213-108761235 CCACTGCACCTGGCCTATTTTGG + Intronic
995221067 5:109648541-109648563 CCACTGCGCCTGGCCTGTATGGG - Intergenic
996497599 5:124179138-124179160 CTACTGCTCCTTTGCTCTATAGG - Intergenic
996505575 5:124264408-124264430 TGACTGCACCTGTTCTTGATTGG + Intergenic
997225936 5:132209493-132209515 CCACCGCACCTGGCCTCTGTTGG - Intronic
997964221 5:138345118-138345140 CCACTGCCCCGGTGCTTTATGGG - Exonic
998194152 5:140052562-140052584 CCACTGCACCTGTCCTGTCCTGG - Intergenic
998279551 5:140792444-140792466 CCACTGCACTTGATATCTCTTGG - Intronic
998782662 5:145675623-145675645 CCACTAAACCAGTTCTCTATTGG - Intronic
998906591 5:146911948-146911970 CCACTGCACCTGGCCTCTTAGGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999721225 5:154400555-154400577 CCAGTGCACCTTCTCCCTATTGG - Intronic
999947747 5:156615689-156615711 CCACTGTTCCTGCTCTCTATGGG + Intronic
1000930197 5:167242335-167242357 CCACTGCACCTGGCCTGTTTAGG + Intergenic
1001594867 5:172891725-172891747 CCACTGCACCTGGCCTATTTAGG + Intronic
1002883158 6:1270839-1270861 CCACTGCATCTGTTGCCTTTGGG + Intergenic
1004063410 6:12220157-12220179 CCACTGAACCTGGCCTCTTTGGG + Intergenic
1004853494 6:19725160-19725182 TCACTGCAACTGCTCTCTTTAGG + Intergenic
1005174167 6:23025000-23025022 CCACTGCACCTGGCCTCTGCTGG + Intergenic
1005618292 6:27596221-27596243 CCACTGCACCTGTCCCATTTTGG + Intergenic
1005652422 6:27896406-27896428 CCACTGCACCTGGTCTGTTTTGG + Intergenic
1007019508 6:38505335-38505357 CCACCGCACCTGGCCTCCATAGG - Intronic
1007273801 6:40658706-40658728 CCACTGCACATGGTCTCTGCTGG + Intergenic
1007491195 6:42223439-42223461 CCACTGCACCTGGCCTCTTTTGG - Intergenic
1007559167 6:42791749-42791771 CCACTGCACCTGGCCTCTGATGG + Intronic
1008492339 6:52099607-52099629 CCACTGCATCTGGCCTCTATTGG - Intergenic
1009270905 6:61612785-61612807 CCACCACACCTCTTCTCCATAGG + Intergenic
1009462711 6:63933492-63933514 CCACCGCACCTGGCCTCTTTTGG + Intronic
1010193803 6:73220824-73220846 CCACTGAGCCTGGTCTCAATTGG - Intronic
1010540728 6:77088841-77088863 CCACTTAAACTGTTCTCTTTTGG - Intergenic
1011582032 6:88879107-88879129 CCACCGCGCCTGGTCTCTAAAGG - Intronic
1013443669 6:110198462-110198484 CCACTGCACCTGGCCCCTGTTGG + Intronic
1013651000 6:112194337-112194359 CCACTGCATTTGCTCTCCATAGG + Intronic
1014324986 6:119982694-119982716 CCACTGCACCTGGCCTTTTTTGG + Intergenic
1015942315 6:138464452-138464474 GCACTGCAGCTGTTCTCCAGCGG - Intronic
1016950557 6:149575499-149575521 CCTCTCCACCTGTTCTGTCTGGG + Intronic
1017755425 6:157525451-157525473 CCACTGCACCTGGCCTCCATTGG + Intronic
1018012093 6:159680646-159680668 CCACTGCACCTGGCCTATATAGG - Exonic
1018031996 6:159848831-159848853 CCACTGCACCTGAACTACATTGG - Intergenic
1018702396 6:166437228-166437250 CCAGCGCACTTCTTCTCTATGGG + Intronic
1019722984 7:2584408-2584430 ACACTGCACCTGTTCTGTTCAGG + Intronic
1021256186 7:18395394-18395416 CCTTTGCACTTCTTCTCTATTGG + Intronic
1022495085 7:30848019-30848041 CCACTGCACCTGGCCACTGTTGG + Intronic
1023065955 7:36378164-36378186 CCAGAGCACCTCTTCTCTAAAGG - Intronic
1028115209 7:86989374-86989396 CCACTGCACCTGTCTGCTCTGGG - Intronic
1029091044 7:98048653-98048675 CAAGTGCCCCTGTTTTCTATAGG + Intergenic
1029634632 7:101775755-101775777 CCACTGCACCTGGCCTCTTGGGG + Intergenic
1031563543 7:123266797-123266819 CCACTGCACCTGGCCTATATTGG - Intergenic
1032485266 7:132282283-132282305 CCATTGCACCTGGCCTATATTGG - Intronic
1032606215 7:133356691-133356713 CCACTGCGCCTGGCCTGTATGGG - Intronic
1032715930 7:134509249-134509271 CCACAGCTTCTGTTCACTATGGG + Intergenic
1033414203 7:141147902-141147924 CCCCTGTACATGTTCTCTTTGGG - Intronic
1033646861 7:143311587-143311609 CCACTGCACCCGGCCTCTTTTGG - Intergenic
1033953056 7:146809649-146809671 CCACTGCACTTGGTCTCTGCTGG + Intronic
1034064394 7:148122514-148122536 CCACTGCACCTGTCCCCTCCTGG - Intronic
1034144558 7:148857461-148857483 CCACTGCACCTGGCCTATTTTGG - Intronic
1034616016 7:152417403-152417425 CCACTGCACCTGGCCTCTAGCGG + Intronic
1034838212 7:154372033-154372055 CTAGGGCACCTGTTCTCTCTGGG - Intronic
1034989950 7:155542080-155542102 CCACTGCACGTGTTCTGCACCGG - Intergenic
1036797461 8:11766668-11766690 CCACTGCACCCGGCCTCTGTGGG - Intergenic
1037344521 8:17884480-17884502 CCACTGCACCAGGCCTCTCTAGG + Intronic
1037421694 8:18709466-18709488 CCACTGCACCTGTTCTGCCAAGG + Intronic
1038357151 8:26839935-26839957 TCACACCACATGTTCTCTATAGG + Intronic
1039612721 8:38932281-38932303 CCACTGCACCTGGTCATTCTTGG + Intronic
1041272801 8:56125331-56125353 CCACTGCACTTGGCCCCTATGGG - Intergenic
1041340025 8:56835214-56835236 CCACTGCACCTGGCCCCTAGAGG - Intergenic
1041592654 8:59607414-59607436 CCACTGCACCTGGTCTGAACAGG + Intergenic
1041811231 8:61912993-61913015 CCACTGCAACTGTTCTCTCAAGG + Intergenic
1043986296 8:86696297-86696319 CTACTGCAGCTGTACTCTCTTGG - Intronic
1045226277 8:100249083-100249105 CCACCACACCTGGCCTCTATAGG + Intronic
1047067828 8:121306259-121306281 TCAATGCATCTGTTCTCTGTTGG - Intergenic
1047110460 8:121784029-121784051 CCACTGCACCTGGCCTATTTGGG - Intergenic
1047581832 8:126224328-126224350 TCACTGCACATGTTCAATATGGG - Intergenic
1048730322 8:137433048-137433070 CCCCTGTACCTGTTGTCCATGGG + Intergenic
1049848210 8:144815262-144815284 CCACTGCACCTGGCCCCTGTTGG - Intergenic
1050453349 9:5807456-5807478 CCACTGCACCTGGCCTGAATGGG - Intronic
1051310606 9:15766947-15766969 CCACTGCACCTGGTTTCTACTGG + Intronic
1052144362 9:25029317-25029339 TCCCTGCACCAATTCTCTATTGG - Intergenic
1052908009 9:33853981-33854003 CCACTGCACCCGTCCCCTAATGG + Intronic
1055664419 9:78539146-78539168 CCACAGCTCCTGTTCTCACTGGG - Intergenic
1056592765 9:87976853-87976875 CCACTGTGCCTGGTCTCTAATGG - Intergenic
1059453657 9:114386677-114386699 CCACTGCCCCTGCTCTCTCAAGG + Intronic
1059520387 9:114935182-114935204 CCACTGCCCCTGTCCTCACTGGG - Intergenic
1059713945 9:116895800-116895822 CCACTGCCCCAGTGCTCTATTGG - Intronic
1059772399 9:117439883-117439905 ACACTGCTCCTGCTCTCTATAGG + Intergenic
1060151486 9:121291705-121291727 CCACTGCACCTGGCCCCCATTGG + Intronic
1062345680 9:136113821-136113843 CCACTGCACCTGGCCTCAAACGG + Intergenic
1062546602 9:137066366-137066388 CCACTGCACCTGTTATGGAGAGG + Exonic
1203486332 Un_GL000224v1:58938-58960 CCACTCCACCTTTGCTCTGTTGG + Intergenic
1203498953 Un_KI270741v1:837-859 CCACTCCACCTTTGCTCTGTTGG + Intergenic
1185652852 X:1661375-1661397 CCCCTGCACCTGCTCCCCATTGG + Intergenic
1185652875 X:1661488-1661510 CCCCTGCACCTGCTCCCCATTGG + Intergenic
1185652924 X:1661730-1661752 CCCCTGCACCTGCTCCCCATTGG + Intergenic
1186622238 X:11253612-11253634 CCACTGCACCTGGCCTATAAAGG - Intronic
1187850992 X:23591576-23591598 CCACTGCCACTGTTCTATATTGG + Intergenic
1188732540 X:33668544-33668566 CCACTGCACCTTGCCTGTATCGG + Intergenic
1189402789 X:40687925-40687947 CCACTGCACCTGGCCTCACTTGG - Intronic
1189680074 X:43506704-43506726 CGAATGCACCTGTGATCTATTGG + Intergenic
1190805206 X:53828814-53828836 TCACTACCCCTGTTCTCTTTTGG + Intergenic
1191159454 X:57312383-57312405 CCACTGTGCCTGGCCTCTATAGG - Intronic
1195397638 X:104428525-104428547 CCACTGCACCTGGCCTAAATTGG - Intergenic
1195948103 X:110237317-110237339 CCACTCTTCCTGTTCTCTGTGGG + Intronic
1196435911 X:115674515-115674537 CCACTGCACCTGGCCTCTCATGG + Intergenic
1196720095 X:118845778-118845800 CCACTGCACCTGGTCTAGATTGG + Intergenic
1198125223 X:133637102-133637124 CCAGTGCACCTGTCTTGTATTGG - Intronic
1198869394 X:141159673-141159695 CCACTGCACCTGGCCTCTATAGG + Intergenic
1199150947 X:144486194-144486216 CCCCTGCACCCTTTCCCTATTGG + Intergenic
1201855621 Y:18537263-18537285 CCACTGAAGCTGGTCACTATTGG + Intergenic
1201877700 Y:18783122-18783144 CCACTGAAGCTGGTCACTATTGG - Intronic
1202073916 Y:21019432-21019454 CCACTGCACCTGGCCACAATCGG - Intergenic
1202078616 Y:21061286-21061308 CCACTGCACCTGGCCACAATCGG - Intergenic