ID: 991718674

View in Genome Browser
Species Human (GRCh38)
Location 5:69475841-69475863
Sequence TCACAGAGACTAGAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991718674_991718679 11 Left 991718674 5:69475841-69475863 CCCTCCCACTCTAGTCTCTGTGA No data
Right 991718679 5:69475875-69475897 AGCACACTAATTCCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991718674 Original CRISPR TCACAGAGACTAGAGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr