ID: 991719281

View in Genome Browser
Species Human (GRCh38)
Location 5:69480531-69480553
Sequence TCACAGAGACTAGAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991719276_991719281 11 Left 991719276 5:69480497-69480519 CCAGGTAGAGGAATTAGTGTGCT No data
Right 991719281 5:69480531-69480553 TCACAGAGACTAGAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991719281 Original CRISPR TCACAGAGACTAGAGTGGGA GGG Intergenic
No off target data available for this crispr