ID: 991723908

View in Genome Browser
Species Human (GRCh38)
Location 5:69517138-69517160
Sequence CCCTGTGATGTCAGTTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 360}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991723908_991723912 22 Left 991723908 5:69517138-69517160 CCTCAGAAACTGACATCACAGGG 0: 1
1: 0
2: 1
3: 21
4: 360
Right 991723912 5:69517183-69517205 TGTCATGAAGGTATGGCCACAGG No data
991723908_991723913 30 Left 991723908 5:69517138-69517160 CCTCAGAAACTGACATCACAGGG 0: 1
1: 0
2: 1
3: 21
4: 360
Right 991723913 5:69517191-69517213 AGGTATGGCCACAGGTTCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 224
991723908_991723910 10 Left 991723908 5:69517138-69517160 CCTCAGAAACTGACATCACAGGG 0: 1
1: 0
2: 1
3: 21
4: 360
Right 991723910 5:69517171-69517193 AGATTGATTTATTGTCATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 241
991723908_991723911 15 Left 991723908 5:69517138-69517160 CCTCAGAAACTGACATCACAGGG 0: 1
1: 0
2: 1
3: 21
4: 360
Right 991723911 5:69517176-69517198 GATTTATTGTCATGAAGGTATGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991723908 Original CRISPR CCCTGTGATGTCAGTTTCTG AGG (reversed) Intronic
900215023 1:1476929-1476951 GCCTGTGATCTCAGCTACTGGGG - Intronic
901104864 1:6747284-6747306 CACTGTGAAGACAGTTTCCGGGG + Intergenic
901240945 1:7692858-7692880 CCCTGGGCTGTGAGTTCCTGGGG - Intronic
901866316 1:12109348-12109370 CCCTCTGATCTCAGCATCTGTGG - Intronic
902686186 1:18079227-18079249 CCCTTTGCTGGCAGATTCTGGGG - Intergenic
902880462 1:19368788-19368810 ACCTGTAATCTCAGTGTCTGGGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904037110 1:27564877-27564899 ACCTGAGATGTCAGTGTCTAGGG + Intronic
904365002 1:30004968-30004990 CCCTGATGTGCCAGTTTCTGTGG + Intergenic
905048139 1:35024991-35025013 GCCTGTGATCTCAGCTACTGGGG - Intronic
906182726 1:43835789-43835811 CCTTGTGCTGTGAGTTCCTGTGG - Intronic
907137174 1:52150640-52150662 CCCTGTAATCTCAGTTACTCAGG + Intronic
907542879 1:55232693-55232715 CCCTCTGCTGTCTGTCTCTGTGG + Intergenic
908646372 1:66282431-66282453 CCTTGTGATGTCAGAGGCTGGGG - Intronic
910064301 1:83134888-83134910 ATTTATGATGTCAGTTTCTGTGG - Intergenic
910214742 1:84831797-84831819 ACCTGTGATAACAGTTTCTTTGG + Intronic
910214832 1:84832722-84832744 ACCTGTGATAACAGTTTCTTTGG - Intronic
910228919 1:84966125-84966147 ACCTGTAATCTCAGTTTCTCGGG + Intronic
910996444 1:93109456-93109478 ACCTGTGATGCCAGCTACTGGGG - Intronic
912803703 1:112739043-112739065 CCATGTTATTTCAGTTACTGTGG - Intergenic
912821424 1:112870959-112870981 CCCTGAGCTCTCAGTTTCTCTGG + Intergenic
912940524 1:114040743-114040765 CCCTGTGAAGACAGTTTCAAAGG + Intergenic
914708264 1:150189257-150189279 GCCTGTAATCCCAGTTTCTGGGG + Intergenic
915145696 1:153794725-153794747 GCCTGTGCTGTTAGTGTCTGTGG + Intergenic
915371840 1:155357893-155357915 ACCTGTAATGTCAGCTACTGGGG - Intronic
915661009 1:157404909-157404931 CCCTGTGATCACAGGGTCTGTGG + Intergenic
918059921 1:181052316-181052338 CCATGTCATGTAAATTTCTGGGG - Exonic
918959530 1:191255555-191255577 CACTGTGACACCAGTTTCTGTGG + Intergenic
919718973 1:200811232-200811254 CCCTGTGGTGGCAGTTTCTTTGG + Intronic
919829004 1:201526210-201526232 GCCTGTAATCTCAGTTACTGGGG + Intergenic
922234261 1:223711733-223711755 ACCTGTGATCTCAGTTACTCGGG - Intronic
1063238786 10:4146720-4146742 GCCTGTAATCTCAGCTTCTGAGG - Intergenic
1063250959 10:4274071-4274093 TCCTGTGATTTCTGTTTCTCTGG + Intergenic
1063611630 10:7567747-7567769 ACCTGTAATCCCAGTTTCTGGGG + Intronic
1063761329 10:9081574-9081596 GCCTGTAATCTCAGTTTCTCAGG + Intergenic
1064008479 10:11716181-11716203 CACTGTGCTGTCATTCTCTGTGG + Intergenic
1064052982 10:12074303-12074325 GCCTGTGATCTCAGCTACTGAGG - Intronic
1064229560 10:13518044-13518066 CCCTGTGATTTTGTTTTCTGAGG - Intronic
1065225331 10:23537992-23538014 CCATGTGATGTCATTTGTTGGGG - Intergenic
1067238565 10:44471776-44471798 CCCTGTGATGCCAGATCATGTGG + Intergenic
1069053687 10:63821456-63821478 ACCTGTGATCTCAGTTACTCAGG + Intergenic
1069322342 10:67187708-67187730 ACCTGTGATTCCAGTTACTGCGG - Intronic
1069477102 10:68744363-68744385 CCTTGTAATCTCAGTTTCTTGGG + Intronic
1070805000 10:79265764-79265786 CCCTGTGGTCTCAGCTGCTGGGG - Intronic
1071286121 10:84147354-84147376 ACCTGTAATGTCAGTTACTTGGG - Intronic
1071979430 10:90988590-90988612 GCCTGTGATCTCAGCTTCTTGGG - Intergenic
1073344363 10:102771295-102771317 GCCTGTGATGTCAGCATTTGAGG + Intronic
1074825916 10:117215911-117215933 CCCTGTGGGGACAGTTTGTGAGG + Intergenic
1075012841 10:118889543-118889565 GCATGTTATGTCAGTTTCTTTGG + Intergenic
1076511655 10:131018433-131018455 TATTGTGATCTCAGTTTCTGTGG - Intergenic
1076741256 10:132486850-132486872 CCCTGGGATGTCGGCTTTTGGGG + Intergenic
1077522723 11:3045844-3045866 CCCTGGGATGACAGTAGCTGTGG - Intronic
1077562838 11:3275240-3275262 GCCTGTGATCTCAGTTACTCGGG + Intergenic
1077568732 11:3321059-3321081 GCCTGTGATCTCAGTTACTCGGG + Intergenic
1078695171 11:13623980-13624002 CACTGTGATGGTAGTTTCTTTGG + Intergenic
1079476607 11:20836908-20836930 CTCTGTGCTGTAAGGTTCTGTGG - Intronic
1080126296 11:28738050-28738072 GTCTGTGATGTAAGTTTCTGAGG + Intergenic
1080479852 11:32636376-32636398 GGCTGACATGTCAGTTTCTGTGG - Intronic
1081026157 11:38017896-38017918 CACAGTGATGTCAGTTTATAGGG + Intergenic
1081387436 11:42488283-42488305 CCCTTTGATTTTACTTTCTGTGG - Intergenic
1081457664 11:43241313-43241335 GCCTGTGATCCCAGTTACTGGGG - Intergenic
1081570459 11:44287420-44287442 CCCTCTGGCCTCAGTTTCTGGGG - Intronic
1081739507 11:45428337-45428359 CCCTGCCAGTTCAGTTTCTGTGG + Intergenic
1083451928 11:62752087-62752109 CCCTTAGATGTTAGTTTTTGGGG + Exonic
1083806631 11:65078327-65078349 CCAGGTGCTGTGAGTTTCTGTGG - Exonic
1084975537 11:72795560-72795582 CCCTGTGAATACAGTCTCTGAGG - Intergenic
1086028248 11:82321124-82321146 CTTGGTCATGTCAGTTTCTGTGG - Intergenic
1087165507 11:94998741-94998763 TCCTGAGCTCTCAGTTTCTGAGG - Exonic
1087495975 11:98890969-98890991 GCCTGTGATGAGAGGTTCTGCGG + Intergenic
1089003306 11:115069783-115069805 TCATGTGATGTGAGTCTCTGCGG + Intergenic
1089515240 11:119027944-119027966 CCCTGTAATGTGAGCTTCTGGGG - Intronic
1089771079 11:120803560-120803582 CCCTGTAATCTCAGCTACTGGGG - Intronic
1090119890 11:124015153-124015175 CCATGAGATTTCAGCTTCTGGGG + Intergenic
1090299457 11:125622950-125622972 CCCTGTAATCTCAGCTACTGGGG + Exonic
1090735346 11:129608215-129608237 CTCTGTGCTGCCAGATTCTGTGG + Intergenic
1090793863 11:130117004-130117026 GCCTGTAATGTCAGTTACTCAGG + Intronic
1091608439 12:1979434-1979456 CCCTGTGATCCCAGCTACTGGGG - Intronic
1093398858 12:18718030-18718052 TCCTGTGTTGCCAGTTTTTGGGG + Intronic
1094321604 12:29190047-29190069 CACTGTGATGCCATTTGCTGAGG + Intronic
1094647093 12:32336048-32336070 TGGTGTGATCTCAGTTTCTGGGG - Intronic
1094787603 12:33867820-33867842 CTATGTTATATCAGTTTCTGTGG + Intergenic
1096038083 12:48490526-48490548 ACCTGTGATCCCAGTTCCTGGGG + Intronic
1096761941 12:53849213-53849235 AGCTGAGATGTCAGTTTTTGGGG + Intergenic
1096857391 12:54493849-54493871 GCTTGTTATGTCACTTTCTGTGG - Intergenic
1098949805 12:76628097-76628119 CACTGTGATGTCTGTCTCTCAGG + Intergenic
1100746339 12:97650392-97650414 TCCTGTTATCTCAGCTTCTGTGG + Intergenic
1100825532 12:98471344-98471366 CCCTGTGTTGTCAGCTACAGTGG + Intergenic
1101884783 12:108652908-108652930 CCATGAGATGGCACTTTCTGAGG - Intronic
1101905672 12:108823790-108823812 GCCTGTAATCTCAGCTTCTGGGG - Intronic
1102068886 12:110000880-110000902 CCCTGTAATCTCAGTTACTTGGG - Intronic
1102772754 12:115492852-115492874 CCCTGGGAAGACAGTTTATGGGG - Intergenic
1102964229 12:117113684-117113706 CCCTGTGATATCTGTGGCTGGGG - Intergenic
1103087738 12:118074396-118074418 ATCTGTGATTTCACTTTCTGAGG + Intronic
1103539379 12:121655221-121655243 GCCTGTGATCCCAGTTACTGGGG + Intronic
1104927729 12:132322293-132322315 CCCTGGGATGTCAGCCCCTGAGG + Intronic
1106333031 13:28756611-28756633 ACCTGTGGTCTCAGTTTCTTGGG + Intergenic
1107174852 13:37388367-37388389 ACCTGTGATCTCAGCTACTGGGG - Intergenic
1107880165 13:44825762-44825784 CACTGTGATATCAGTTTCTAGGG + Intergenic
1111232373 13:85360903-85360925 ACCTGTGATATCAGCTACTGGGG + Intergenic
1111512331 13:89282552-89282574 CCCTGTAAAGTCAGTCTCTGGGG - Intergenic
1112532438 13:100217948-100217970 CCCTGTAATGTCAGCTACTCGGG + Intronic
1113064062 13:106356540-106356562 GCCTGTAATGCCAGTTACTGGGG - Intergenic
1113156214 13:107325714-107325736 ACCTGTAATCTCAGTTACTGGGG + Intronic
1113297072 13:108970688-108970710 CCCAGTGATGACAATTTATGAGG - Intronic
1113868129 13:113542535-113542557 CACTGACATGTTAGTTTCTGTGG - Intronic
1114152981 14:20065395-20065417 GCCAGTGATGTCAGTTTCTCTGG - Intergenic
1115089122 14:29552885-29552907 ACCTGTGATGAAAGTTTTTGCGG + Intergenic
1115314690 14:32013616-32013638 CCCTGTGGGGGCAGTTTCAGTGG + Intronic
1115578645 14:34736425-34736447 ACCTGTGATCTCAGTTACTCTGG - Intergenic
1120838981 14:89066325-89066347 ATCTGTGATTTCAGATTCTGTGG - Intergenic
1121275987 14:92667974-92667996 CCCTAAGATGTCATGTTCTGAGG + Intronic
1122531360 14:102429737-102429759 CCCTTTGATGACACTGTCTGAGG - Intronic
1122734733 14:103831432-103831454 CCCTGTAATGCCAGCTACTGGGG - Intronic
1126513223 15:49503458-49503480 CACTGTGATGGTAGTTTCTTTGG - Intronic
1126622305 15:50652206-50652228 GCCTGTAATGCCAGCTTCTGAGG + Intronic
1127552655 15:60056315-60056337 GCCTGTGATGTCAGCTACTCGGG - Intronic
1128025119 15:64429190-64429212 GCCTGTAATCTCAGCTTCTGGGG + Intronic
1128504903 15:68261258-68261280 CTCTGTGATTTCACTTTCTGTGG + Intergenic
1129253242 15:74320008-74320030 CCCTGGGAGGGCAGCTTCTGTGG + Intronic
1129699508 15:77759487-77759509 CCCTGTGATGTCAGTGTAATTGG - Intronic
1129881110 15:79006518-79006540 TCCTGTGTTGTCAGTGTGTGGGG - Intronic
1130240734 15:82186870-82186892 CGCTGAGATGTCAGTTCCAGGGG - Intronic
1130455493 15:84102485-84102507 GCCTGTAATGCCAGTTTATGTGG - Intergenic
1130622760 15:85480810-85480832 ACCTGTAATCCCAGTTTCTGGGG - Intronic
1132988495 16:2780447-2780469 CCCTGTGGTGTCACCCTCTGGGG - Intergenic
1133132427 16:3685502-3685524 CCCTGGGATGACAGGTCCTGAGG + Intronic
1133729469 16:8567437-8567459 TTCTGTGTTGTCAGTTCCTGAGG + Intergenic
1134637945 16:15807250-15807272 GCCTGTGATTTCAGTTACTTGGG - Intronic
1135305015 16:21360292-21360314 GCCTGTGTGGTCAGTTTTTGAGG - Intergenic
1135338393 16:21624600-21624622 GCCTGTAATCTCAGTTACTGGGG + Intronic
1135571535 16:23553009-23553031 GCCTGTGGTTTCAGTTACTGAGG + Intronic
1136185792 16:28588217-28588239 CTCTGTGAAGTTAGTTTATGGGG - Intronic
1137020706 16:35424251-35424273 GCCTGTAATCTCAGTTACTGAGG + Intergenic
1137769045 16:51001137-51001159 CTCAGGGATGTCATTTTCTGTGG - Intergenic
1138066226 16:53944270-53944292 CCCTGGGATGTGGGTTTCTATGG - Intronic
1138406693 16:56801026-56801048 CACTGTTTTGTCATTTTCTGTGG + Intronic
1139194361 16:64901388-64901410 GCCTGTAATGTCTTTTTCTGGGG - Intergenic
1139391938 16:66610712-66610734 CCCTGTGCTGGCAGTGCCTGTGG + Intronic
1139535857 16:67573125-67573147 ACCTGTAATGCCAGTTTCTCGGG + Intronic
1139914232 16:70418418-70418440 CCCTGGGATGCCAGTCTCTGAGG - Intronic
1140027539 16:71304212-71304234 CACTGGGGTGTCAGTATCTGTGG + Intergenic
1141698108 16:85629921-85629943 CTTTGTTATCTCAGTTTCTGTGG + Intronic
1141966689 16:87449918-87449940 GCCTGTGGTCTCAGTTACTGGGG + Intronic
1142720019 17:1769856-1769878 CCCTGTGCTGTCGGGGTCTGGGG - Exonic
1143820776 17:9560271-9560293 ACCTGTAATCTCAGTTACTGGGG + Intronic
1144253329 17:13441015-13441037 CCCTGTGATGACACTCTGTGGGG + Intergenic
1145328453 17:21850823-21850845 CCCTGTGCTGTCAGTGTGTTAGG + Intergenic
1145388564 17:22436642-22436664 ACCTGTGGTCTCAGCTTCTGGGG - Intergenic
1145837241 17:27963774-27963796 GCCTCTGGTGTCAGTTCCTGGGG + Intergenic
1146720186 17:35118657-35118679 CCCTGGGATGCCAGCTTCTACGG - Intronic
1147263338 17:39221445-39221467 CTCAGAGATGTAAGTTTCTGGGG - Intronic
1147729265 17:42587583-42587605 CCCTGGCATGTCAGGTTATGGGG + Intronic
1147975387 17:44244961-44244983 GCCTGTGATCCCAGTTTCTCAGG + Intergenic
1148574109 17:48696233-48696255 CCCTGTGGTCTCAGTTACTCAGG - Intergenic
1148641815 17:49193340-49193362 CCCTGTAATCTCAGCTACTGGGG + Intergenic
1149609418 17:57949263-57949285 GCCTGGAATTTCAGTTTCTGTGG - Intronic
1151859186 17:76747032-76747054 GCCTGTAATGCCAGTTACTGAGG - Intronic
1152559104 17:81068991-81069013 CCCTGTCCTGTCTGTTTCTACGG - Intronic
1152725862 17:81945575-81945597 GCCTGTAATCTCAGTTACTGGGG + Intronic
1203170260 17_GL000205v2_random:141939-141961 ACCTGTAATCCCAGTTTCTGGGG - Intergenic
1153052053 18:908800-908822 CCCTGTGCTCTCAGTTTCTCTGG - Intronic
1153557021 18:6325442-6325464 ACCTGTAATCTCAGTTACTGGGG - Intronic
1155201700 18:23523325-23523347 CCCTGTCATGTGAGGTTTTGGGG + Intronic
1155511350 18:26580616-26580638 CTCTGGTATGTGAGTTTCTGTGG - Intronic
1157256675 18:46145735-46145757 ACCTGTGATCTCAGTTACTCAGG + Intergenic
1157756778 18:50225664-50225686 ACGTCTGTTGTCAGTTTCTGTGG + Intergenic
1157974878 18:52315590-52315612 CACTGTGATGATAGTTTCTTTGG + Intergenic
1158478276 18:57799582-57799604 GCCTGTGATCTCAGTTACTCGGG + Intronic
1159015263 18:63097263-63097285 CCCTCTGTTTTCAGTCTCTGGGG - Intergenic
1161173138 19:2823339-2823361 CCCTGGGGTGTCAGTTTTTCTGG + Intronic
1161213992 19:3084062-3084084 GCCTGTGGTCTCAGTTTCTTGGG - Intergenic
1161749395 19:6083694-6083716 ACCTGTGGTCTCAGCTTCTGGGG - Intronic
1161825904 19:6565109-6565131 GCCTGTAATCCCAGTTTCTGGGG - Intergenic
1163369740 19:16895286-16895308 CCCTGTAATCCCAGCTTCTGGGG + Intronic
1164530021 19:29041549-29041571 CCCTGTGGTCTGAGTTTCAGAGG - Intergenic
1164865003 19:31597422-31597444 ACCTGTGATCTCAGTTACTGGGG + Intergenic
1164957337 19:32397859-32397881 CAATGTGATGTCAGTGACTGTGG + Intergenic
1165760249 19:38316783-38316805 GCCTGTGGTGCCAGTTACTGGGG - Intronic
1166121165 19:40687680-40687702 GCCTGTGACGTCAGTATCTTGGG - Intronic
1166526829 19:43516116-43516138 ACCTGTGGTTTCACTTTCTGTGG - Intronic
1166550444 19:43662371-43662393 GCCTGTAATCTCAGTTTCTTGGG + Intronic
1166667242 19:44688299-44688321 ACCTGTGATGTCAGCTACTCGGG - Intergenic
1168497140 19:56862958-56862980 CCCTGTGCTGCCAGGTGCTGTGG + Intergenic
924999593 2:394303-394325 TCCTGTGAAGTCAGGCTCTGAGG + Intergenic
925386548 2:3465914-3465936 GGCTGTGATGACACTTTCTGTGG - Intronic
925622644 2:5808698-5808720 CCCTGTCATGTCAGTGGCCGTGG - Intergenic
926188130 2:10707517-10707539 ACCTGTAATCTCAGTTCCTGAGG + Intergenic
927730715 2:25469200-25469222 AACTTTGATGTCACTTTCTGAGG - Intronic
928185929 2:29110811-29110833 ACCTGTGATCTCAGCTTCTTGGG - Intronic
928892306 2:36218175-36218197 CACTCTGATGTTAGTTTCTTTGG - Intergenic
928985331 2:37175218-37175240 CCCTGTGTTTTTAGTTTCTTGGG - Exonic
929378487 2:41320239-41320261 TCCTGTGATTTCTGTTTTTGTGG - Intergenic
930234028 2:48871947-48871969 CCCTGTGATGTTAAATTATGGGG + Intergenic
930389405 2:50741833-50741855 CCCTGTGATTTTTGTTTCTGGGG - Intronic
930432636 2:51299733-51299755 CCATATGATTTCAGCTTCTGTGG - Intergenic
931828703 2:66028257-66028279 CATGGTGATATCAGTTTCTGGGG - Intergenic
932220228 2:69993494-69993516 CACTGTGATCTCAGGTTCAGGGG - Intergenic
932424406 2:71620013-71620035 CCCACTGATGTCAGGTTTTGGGG + Intronic
932697024 2:73965499-73965521 CCCAGCGCTGTCAGTTACTGTGG - Intergenic
932816844 2:74868607-74868629 TCTTGTGCTGTCACTTTCTGTGG + Intronic
933014672 2:77110096-77110118 TCCTGTGATGTCTGTGTCTAAGG - Intronic
933203158 2:79474515-79474537 CCTTGTGGTGTAAATTTCTGTGG - Intronic
937645384 2:124260550-124260572 CACTCTGATGGCAGTTTCTTTGG - Intronic
937671954 2:124547557-124547579 TCCTGTTGTGTCAGTATCTGGGG + Intronic
938314283 2:130315386-130315408 CCCTGTGATGGGTGTTCCTGTGG + Intergenic
938705744 2:133923978-133924000 CCCTGTGTTCACAGGTTCTGAGG - Intergenic
943095336 2:183421608-183421630 CACTGTGATGGCAGTTTCTTTGG - Intergenic
944306292 2:198183748-198183770 CCCTGTGATTCCTGTTGCTGTGG + Intronic
944720326 2:202417259-202417281 CCCTGTAATCTCAGTTACTCAGG - Intronic
946641113 2:221784415-221784437 ACCTGTGATCTCAGTTACTCAGG + Intergenic
947530480 2:230905938-230905960 GCCTGTGATGGTAGTTTCAGGGG + Intergenic
948453612 2:238093674-238093696 CCTGGTGAAGTCAGTTTCTGGGG + Intronic
1168756512 20:322145-322167 ACCTGTCATCTCAGCTTCTGGGG - Intergenic
1169081004 20:2797752-2797774 CCCTGTGGTGGCATTATCTGGGG + Intronic
1172713627 20:36946788-36946810 GCCTGTGATTTCATTTTCTATGG + Exonic
1172952787 20:38732529-38732551 GCCTGTGGTGTCAGTTGCTCGGG - Intergenic
1174250257 20:49214085-49214107 CCCTGTAATCCCAGTTTCTTGGG + Intergenic
1174482937 20:50844017-50844039 CCCTGTGGTCTCAGTTACTCAGG + Intronic
1175729441 20:61343952-61343974 CCAAGTGAAGTCAGTTTCTCAGG - Intronic
1175861247 20:62151500-62151522 CCCTGTGGTCTCAGGCTCTGAGG - Intronic
1176427055 21:6554626-6554648 CCCTGTGATGTCAGTGTGCCAGG + Intergenic
1177592882 21:23195373-23195395 GCCTGTAATGTCAGTTACTTGGG - Intergenic
1178359397 21:31935446-31935468 CTCTGTGATGTCCAGTTCTGTGG + Intronic
1179031745 21:37726659-37726681 CTCTGAGTTGTAAGTTTCTGTGG + Intronic
1179283066 21:39951499-39951521 CCCTGTGATTTTAGATTATGTGG + Intergenic
1179702546 21:43162948-43162970 CCCTGTGATGTCAGTGTGCCAGG + Intergenic
1181109035 22:20590738-20590760 CCCAGTGAGGACAGGTTCTGAGG - Intergenic
1181693171 22:24577446-24577468 GCCTGTAATCTCAGTTACTGGGG + Intronic
1182417046 22:30228139-30228161 GCCTGTGATCTCAGCTACTGGGG + Intergenic
1183282264 22:36938079-36938101 CCCTGTGAAGTCAGGGTTTGAGG + Exonic
1183402894 22:37615051-37615073 ACCTGTAATCTCAGTTACTGGGG + Intronic
1184018632 22:41804943-41804965 GCCTGTGATCCCAGTTACTGGGG + Intronic
950185157 3:10940216-10940238 CCCTGAGCTGTCTGGTTCTGCGG + Exonic
950406031 3:12805410-12805432 GCCTGTAATGTCAGCTACTGAGG - Intronic
952219435 3:31310066-31310088 GCCTGTGATGTCAGCTACTCGGG - Intergenic
952379968 3:32796895-32796917 CCCTGTAATTTCAGCTACTGGGG - Intergenic
953137307 3:40192272-40192294 CCCTCTGATTTCATTTACTGCGG + Intronic
953937584 3:47059239-47059261 CCCTGTAATCCCAGTTACTGGGG - Intronic
954226895 3:49187961-49187983 CCCTTACATGTCTGTTTCTGAGG + Intronic
954242671 3:49306325-49306347 GCCTGTGATGTCAGCTACTCAGG - Intronic
955020007 3:55110671-55110693 ACCTGTCAGGTCAGTTTCTCGGG - Intergenic
955383331 3:58458991-58459013 GCCTGTAATCTCAGCTTCTGGGG - Intergenic
955882645 3:63564319-63564341 CCCTGTAATCTCAGCTACTGGGG - Intronic
956710474 3:72034823-72034845 CCCAGAGATGGCAGCTTCTGGGG + Intergenic
958438704 3:94129875-94129897 GCCTGTGATCTCAGTTACTTGGG - Intergenic
959282154 3:104357763-104357785 TCCTGTGAGGTCAGTTGCTGGGG + Intergenic
959299000 3:104575797-104575819 GCCTAAGATGACAGTTTCTGGGG - Intergenic
959502276 3:107120048-107120070 CTCTGTGATTTCAGTGTCAGTGG - Intergenic
960422116 3:117459676-117459698 GCCTCTGATGTCAGTTCCAGTGG - Intergenic
961314641 3:126026246-126026268 CATTGTGTTTTCAGTTTCTGGGG - Intronic
961495107 3:127285613-127285635 ACCTTAGATGTCAGTTTCTTGGG - Intergenic
963045531 3:141100251-141100273 CCCAATGAGGTCACTTTCTGAGG - Intronic
963343549 3:144067373-144067395 GCCTGTAATCTCAGTTACTGGGG + Intergenic
963623621 3:147643522-147643544 CCCTTTGATGTCAGTTAATCAGG - Intergenic
963719553 3:148845444-148845466 CCCTGTGATGAAACTTACTGTGG + Exonic
963977170 3:151493886-151493908 ACTTGTCATCTCAGTTTCTGTGG - Intergenic
964826058 3:160829253-160829275 GCCTTTTATGTCTGTTTCTGTGG + Intronic
966458453 3:180145609-180145631 CCCTGTGATCCCAGTTACTCAGG - Intergenic
966929631 3:184667628-184667650 ACCTGTAATCCCAGTTTCTGGGG + Intronic
967286849 3:187880009-187880031 ACCTGTAATCTCAGTTACTGGGG - Intergenic
968929377 4:3570507-3570529 ACCTGTGATTACAGGTTCTGGGG - Intergenic
969354564 4:6617803-6617825 CCCTGTGATCCCAGTTACTTGGG - Intronic
969791534 4:9496806-9496828 CCCTGTGATCCCAGCTTCTCTGG + Intergenic
971237548 4:24856321-24856343 CCATTCGATGTCAGTTTCTAAGG - Intronic
971789637 4:31152635-31152657 CCCTGCTATGTCAATTACTGGGG + Intergenic
972294611 4:37724739-37724761 GCCTTTGCTGCCAGTTTCTGAGG + Intergenic
972724435 4:41734053-41734075 CCCTGTAATCCCAGTTACTGGGG - Intergenic
972980759 4:44698019-44698041 GCCTGTGATCTCAGTTACTCGGG + Intronic
976786694 4:88829312-88829334 GCCTGTGATCTCAGCTTCTTGGG + Intronic
978063639 4:104369293-104369315 CCCAGTGATTTCAGTTAGTGAGG - Intergenic
978227598 4:106356271-106356293 ATCTGTGATTTCACTTTCTGTGG - Intergenic
979378456 4:119977887-119977909 CCAAGTGATGACAGTTTCTCAGG + Intergenic
980082488 4:128358782-128358804 CCATCTGATGACAGTCTCTGTGG - Intergenic
982317428 4:154046009-154046031 CCCTGTGTTGTCAGCTCCTGAGG - Intergenic
982731183 4:158957054-158957076 ACCTGTAATCTCAGTTACTGGGG - Intronic
982919438 4:161255000-161255022 CCCAGTGATCTCTGTCTCTGGGG + Intergenic
984195008 4:176648784-176648806 GCCTGTGATCTCAGCTACTGAGG + Intergenic
985002977 4:185503821-185503843 CCCTGTAATCTCAGCTACTGGGG + Intronic
985209646 4:187578812-187578834 CCTTCTCATGTCATTTTCTGAGG + Intergenic
988286352 5:29222422-29222444 CATTGTGGTATCAGTTTCTGTGG + Intergenic
989104410 5:37847626-37847648 CCCTGTGTTGGCAGTTGCTGAGG + Intergenic
989464742 5:41741649-41741671 CCCAGCGATGTGTGTTTCTGGGG - Intronic
989602114 5:43210022-43210044 CACTGTAATGTGCGTTTCTGTGG - Intronic
990303937 5:54476758-54476780 CCCTGTTTTGTCAGTTACTCTGG - Intergenic
991578821 5:68133055-68133077 GCCTGTAATGCCAGTTACTGGGG - Intergenic
991723908 5:69517138-69517160 CCCTGTGATGTCAGTTTCTGAGG - Intronic
993489288 5:88526462-88526484 CCATGTGATGTCACTGACTGTGG + Intergenic
994476543 5:100278312-100278334 ACCTGTGATGCCAGTTGCTTGGG - Intergenic
994932631 5:106208245-106208267 GCCTGTAATCTCAGTTTCTTGGG - Intergenic
994943488 5:106355871-106355893 CCCTGTCATGTCTGGTTCTGAGG + Intergenic
995145788 5:108786023-108786045 CCTTCTAATTTCAGTTTCTGTGG + Intronic
995977510 5:118058255-118058277 GCCTGTAATCTCAGCTTCTGGGG - Intergenic
996362547 5:122666282-122666304 GCCTTTGATGTTATTTTCTGAGG - Intergenic
998120071 5:139568844-139568866 ACCTGTGATCCCAGTTACTGGGG + Intronic
998332901 5:141345331-141345353 CAGGGTGATGTGAGTTTCTGTGG - Exonic
999631969 5:153580688-153580710 CACTCTGGTGCCAGTTTCTGGGG + Intronic
1000072816 5:157756708-157756730 CCCTGTGAGGTAGGTGTCTGTGG - Exonic
1001026304 5:168227087-168227109 CTCTGAGATGTCAGCTTTTGGGG - Intronic
1003074643 6:2972095-2972117 GCCTGTAATCTCAGTTGCTGGGG + Intronic
1003206275 6:4015476-4015498 CCCTGTAATCCCAGTTACTGGGG + Intergenic
1003959081 6:11192392-11192414 CCCTGTGTTTTCAGTTCCAGTGG - Exonic
1004098106 6:12579722-12579744 CCCTGTGATCTCAGCTACTCAGG - Intergenic
1004321024 6:14631624-14631646 CACTGTGATGTGAGTCTCTCAGG + Intergenic
1005170550 6:22980332-22980354 CCTGGTGATGTGAGTTTGTGAGG - Intergenic
1006237438 6:32646772-32646794 CCCTGTGATGTCATTCACTGTGG - Intronic
1006954211 6:37852838-37852860 GCCTGTGATCTCAGCTTCTTGGG - Intronic
1007723627 6:43900931-43900953 CCCTGTGATGGCAGAGTCAGCGG - Intergenic
1007998605 6:46335149-46335171 CCCTGTGATGTCAGAAGCTTGGG + Intronic
1008740862 6:54606160-54606182 CACTCTGATGACAGTTTCTTTGG + Intergenic
1010310681 6:74381509-74381531 CACTCTGATGACAGTTTCTTTGG + Intergenic
1012019185 6:93894686-93894708 ATCTGTGGTTTCAGTTTCTGTGG + Intergenic
1012117638 6:95323219-95323241 CACTCTGATGACAGTTTCTTTGG + Intergenic
1013136098 6:107283908-107283930 GCCTCTGATCTCAGTTACTGAGG + Intronic
1014295521 6:119612690-119612712 CCTTGTGATGTAACTTTCAGAGG - Intergenic
1014874538 6:126640827-126640849 ACCTGTGATGTCAGTTGTTTTGG + Intergenic
1015561331 6:134519253-134519275 ACCTGTGATCTCAGTTACTCAGG + Intergenic
1016087046 6:139927157-139927179 CCCTTCGATGTCAGTTTCTTTGG - Intergenic
1016275114 6:142340877-142340899 CCCTGTTACATCATTTTCTGTGG + Intronic
1017832843 6:158147261-158147283 CCCTGTGATCTCAGCTACTCAGG - Intronic
1019133850 6:169896323-169896345 CACTGAAATGTCAGCTTCTGGGG + Intergenic
1019440324 7:1042722-1042744 CCCTGTAATGCCAGGCTCTGTGG - Intronic
1019826597 7:3289650-3289672 CCCTATGTAGTCATTTTCTGAGG + Intergenic
1020198990 7:6064607-6064629 GCCTGTGATCTCAGCTACTGGGG - Intergenic
1021236879 7:18153333-18153355 CCCTGTTATGGAATTTTCTGGGG + Intronic
1021888964 7:25168848-25168870 CCCTGTAATGTCAGCTACTCGGG - Intronic
1023093953 7:36641272-36641294 CCCTGTGATGCCAGTTTTGAAGG - Intronic
1023220112 7:37913064-37913086 CACTGTCATGTCATTCTCTGGGG - Intronic
1023449100 7:40263045-40263067 ACCTGTGATCTCAGCTACTGGGG - Intronic
1024011465 7:45270626-45270648 ACCTGTGATCTCAGCTTCTCGGG - Intergenic
1024608659 7:51044215-51044237 ACATGTGAGGCCAGTTTCTGTGG + Intronic
1024886283 7:54146418-54146440 CCCTGTAATCCCAGTTACTGGGG + Intergenic
1027279808 7:76599854-76599876 ATTTATGATGTCAGTTTCTGTGG + Intergenic
1028275366 7:88849622-88849644 ACCTGTGATCTCAGTTACTTGGG - Intronic
1029563296 7:101318393-101318415 ACCTGTGATCTCAGCTACTGGGG + Intronic
1029639801 7:101814051-101814073 CCCTGGCATGTCTATTTCTGCGG - Intergenic
1029928745 7:104347765-104347787 CCCTGTAATCCCAGTTACTGGGG + Intronic
1031626493 7:123998477-123998499 GCCTGTGATCTCAGTTACTTAGG + Intergenic
1033255641 7:139799191-139799213 ACCTGTGGTGTCAGCTTCTCGGG - Intronic
1034344886 7:150379781-150379803 CCCTGATAGATCAGTTTCTGGGG + Intronic
1035216828 7:157373920-157373942 CCCTGTAATGCCAGCTACTGGGG + Intronic
1036480239 8:9133015-9133037 CGCTTTGATGTTACTTTCTGGGG + Intergenic
1036569946 8:9971408-9971430 CCCTGTGGTCCCAGTTACTGAGG - Intergenic
1037105010 8:15096199-15096221 ACCTGTAATCTCAGTTTCTTGGG - Intronic
1037646622 8:20798278-20798300 CCCTATGTTGTCAGTTTCACTGG + Intergenic
1037667432 8:20982240-20982262 CCCTGTGATGTGAGGTTCAAGGG - Intergenic
1039598759 8:38815542-38815564 GCCTGTAATCTCAGTTTCTTGGG - Intronic
1040597396 8:48852841-48852863 CCCTCTGCTGTCAGTTTGGGGGG - Intergenic
1044122273 8:88412432-88412454 CCCTGTAATATCAGCTACTGGGG + Intergenic
1046183991 8:110689474-110689496 CCCTGTGATCTCAGCTACTCAGG + Intergenic
1046323691 8:112612840-112612862 CCCTGTGATTTCGGTGTCTCTGG - Intronic
1049829347 8:144690235-144690257 ACCTGTAATCTCAGCTTCTGGGG - Intergenic
1049955807 9:691736-691758 CCCTGTAGTCTCAGTTTCTCGGG - Intronic
1050683938 9:8146270-8146292 CCCTGTGATGTCCCTTACAGTGG - Intergenic
1051781932 9:20698523-20698545 CCCTGTGGTCTCAGTTACTCAGG - Intronic
1052122540 9:24736230-24736252 CCCTGTGATGTTAGTAGATGAGG - Intergenic
1053804069 9:41783944-41783966 ACCTGTGATTACAGGTTCTGGGG - Intergenic
1054141213 9:61531515-61531537 ACCTGTGATTACAGGTTCTGGGG + Intergenic
1054192375 9:61995440-61995462 ACCTGTGATTACAGGTTCTGGGG - Intergenic
1054460903 9:65461951-65461973 ACCTGTGATTACAGGTTCTGGGG + Intergenic
1054646031 9:67593251-67593273 ACCTGTGATTACAGGTTCTGGGG + Intergenic
1058127778 9:101215402-101215424 CCCTGTGATCTCAGCTACTCAGG - Intronic
1059307302 9:113364059-113364081 CCCTGTAATCTCAGTTACTGGGG + Intronic
1059476160 9:114549643-114549665 CTCTGTCATGTCAGTTTCTGCGG + Intergenic
1059488169 9:114643436-114643458 GCCTGTGATGTCAGCCACTGGGG + Exonic
1060648675 9:125305493-125305515 ACCTGTGATCCCAGTTACTGGGG - Intronic
1061094775 9:128449828-128449850 ACCTGTGATCTCAGCTACTGGGG - Intergenic
1186378094 X:9029256-9029278 ACCTGTTATGTCAGTGTCTCAGG - Intronic
1186744805 X:12556615-12556637 ATCTGTTATCTCAGTTTCTGTGG - Intronic
1186880404 X:13860029-13860051 CTGTGTGATATCAGTTGCTGAGG - Intronic
1187701542 X:21968354-21968376 CCCTGTGACCTCAATTTCTGGGG - Intronic
1189178257 X:38979497-38979519 GCCTGTAATGTCAGTTACTTGGG + Intergenic
1193829085 X:86265690-86265712 TCCTGTGATCTCAGAATCTGTGG - Intronic
1195489251 X:105448487-105448509 ACCTGTAATGTCAGCTACTGAGG - Intronic
1196232426 X:113239794-113239816 CTCTGTGATGGCAGTGTCTATGG - Intergenic
1196249334 X:113440855-113440877 GTCTTTGATGTCAGTTTTTGTGG - Intergenic
1196288053 X:113905543-113905565 ACCTGTAATGTCAGCTACTGGGG - Intergenic
1197035312 X:121866877-121866899 GCCTGTGGTTTCATTTTCTGTGG + Intergenic
1197168359 X:123404280-123404302 CCCTGTGAGGTCAGCGTCCGTGG - Intronic
1197756105 X:129996023-129996045 CCCTGAGATCTCAGTGTCAGTGG + Intronic
1198084121 X:133266633-133266655 GCCTGTAATTTCAGTTACTGGGG - Intergenic
1198675255 X:139124175-139124197 CCCTGGGATGTGAGTATATGTGG + Intronic
1198736229 X:139788144-139788166 TCCTGTGATTTCACTTTCTTAGG + Intronic
1200405004 Y:2800923-2800945 CCCTGTAATGCCAGTTACTTGGG + Intergenic