ID: 991726711

View in Genome Browser
Species Human (GRCh38)
Location 5:69542743-69542765
Sequence CTGTGTGTAATCAGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991726711 Original CRISPR CTGTGTGTAATCAGAAAAGA AGG (reversed) Intronic
900492724 1:2960601-2960623 CTCTGTGTGATCAGACCAGAAGG - Intergenic
900492737 1:2960705-2960727 CTCTGTGTGATCAGACCAGAAGG - Intergenic
900492750 1:2960774-2960796 CTCTGTGTGATCAGACCAGAAGG - Intergenic
904230892 1:29070606-29070628 CTTTCTGTGATCAGAAAACAGGG + Intronic
904889487 1:33768572-33768594 GTGTGTGTCACCAGAACAGAAGG + Intronic
905429478 1:37911001-37911023 CTGTGTGTAATGAAAAAGGTTGG - Intronic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906645180 1:47469754-47469776 TAGTGGGTACTCAGAAAAGATGG - Intergenic
907673104 1:56493866-56493888 GTCTGTGTAATCAGCAAGGAGGG + Intergenic
908039295 1:60090714-60090736 CTCTGTATGATGAGAAAAGAAGG + Intergenic
908090332 1:60678753-60678775 CTGTGTGTACTGAGCAAAGGGGG - Intergenic
908569889 1:65398402-65398424 CAGTGTGCAATAAGAAAAGGGGG - Intronic
908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG + Intronic
909777517 1:79500888-79500910 CTCTATATAATCAGAAAACATGG + Intergenic
909787061 1:79627051-79627073 CAGTGAGTATTCAGAAATGAAGG - Intergenic
910207105 1:84759176-84759198 CTGTGTGTGAGAAAAAAAGAAGG - Intergenic
910220329 1:84883425-84883447 ATGTGTACAATCAGGAAAGAGGG + Intronic
911071381 1:93834493-93834515 CTGTGTGTAATGAAAAAGGTTGG - Intronic
913196680 1:116462574-116462596 CTGTGTGAAATCTGAAAGGATGG + Intergenic
916532380 1:165669481-165669503 ATGTGTGTAAGGAGAAAAAAGGG + Intronic
916584185 1:166135851-166135873 CTGTGTGTGTTCTGCAAAGATGG + Intronic
917643056 1:177001911-177001933 TTGTGTATAACCACAAAAGAAGG - Intronic
917689072 1:177448940-177448962 CTTTGTGAAATCTGAAAACAGGG - Intergenic
918991900 1:191707669-191707691 CTGTGTGCAGTCAGAACAGTTGG - Intergenic
921504157 1:215946147-215946169 CTATGTGTCATCACAAATGATGG + Intronic
921667009 1:217884641-217884663 CTGTTTGAAATAAGAAAAAAAGG + Intergenic
922599251 1:226837140-226837162 CTGTGTGTAAGGAAAAAGGATGG - Intergenic
922845165 1:228679000-228679022 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
923892602 1:238232851-238232873 TTGTGTATAATGACAAAAGAAGG + Intergenic
924600676 1:245486071-245486093 CTATTTGTAATCAGGAAATATGG - Intronic
1065062121 10:21913151-21913173 CTGTTAGTAATGAGAAAAGATGG + Intronic
1065623229 10:27605234-27605256 CTGTTTGTAATAGGAAAAAATGG + Intergenic
1067215892 10:44302476-44302498 ATGTGTGAAATGAGAAAACAAGG + Intergenic
1068551465 10:58412743-58412765 CTGTGTGTAATCAGTCATTAGGG - Intergenic
1068813834 10:61287351-61287373 TTGTGTGTAAACAGAAAATGGGG - Intergenic
1069312361 10:67054044-67054066 GTGTCTGTAATCTGCAAAGATGG - Intronic
1069390669 10:67931349-67931371 CTGAGACTAATCAGAAAAAAAGG + Intronic
1070410993 10:76140264-76140286 CTGTCTGTACCAAGAAAAGAAGG + Intronic
1070678525 10:78432866-78432888 GAGAGTGGAATCAGAAAAGATGG + Intergenic
1071531626 10:86393816-86393838 CTGTGAATAATCAGAAGAGTTGG - Intergenic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074293166 10:112156719-112156741 CTTAGAGTATTCAGAAAAGACGG + Intronic
1075068851 10:119307777-119307799 CAGTGTGTATGCAGAAAGGAGGG - Intronic
1075602748 10:123782564-123782586 CTTTGTCTAATCAGAATAAATGG - Intronic
1075893143 10:125971423-125971445 TTGTGTGCAAGCAGAAGAGAAGG - Intronic
1076082736 10:127598321-127598343 CTGTGTTTGAGCTGAAAAGAAGG + Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078497969 11:11839570-11839592 GAGTGTGCAATCAGAAAAGGGGG + Intergenic
1078770441 11:14345591-14345613 GTGTGTGTATTCTTAAAAGAAGG - Intronic
1078827791 11:14947518-14947540 GTGTGTGTGTTCAGAAAAAAGGG + Intronic
1078882787 11:15468840-15468862 CTGTGTGTAAATAGAAAAGGTGG + Intergenic
1079264533 11:18917933-18917955 CTGTGTGAAATAAGTAAAGGTGG + Intergenic
1079266699 11:18940162-18940184 CTGTGTGAAATAAGTAAAGGTGG + Intergenic
1080797774 11:35581426-35581448 CTTTGTGTAATCACAGAAGTGGG - Intergenic
1082240509 11:49864622-49864644 ATCTTTGTAATTAGAAAAGAGGG + Intergenic
1084354461 11:68628024-68628046 CTGTGTGTAATGAAAAGAGTGGG - Intergenic
1084585702 11:70060833-70060855 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1084617455 11:70246043-70246065 CTGTGTGTCATCAGAAGGGCAGG + Intergenic
1085570450 11:77553756-77553778 CTGTGTGTAATGAAAAAAGTTGG - Intronic
1085822564 11:79808319-79808341 TTAAGTGTAATCAGAAAGGAGGG - Intergenic
1086680450 11:89664306-89664328 ATCTTTGTAATTAGAAAAGAGGG + Intergenic
1087572792 11:99951219-99951241 CTGTGTGTAATAGGGAAAGTGGG + Intronic
1087601855 11:100327373-100327395 CTGTGTGCAGTCTGGAAAGAGGG - Intronic
1087710894 11:101549992-101550014 TTCTGTGTCATCAGAAAAAAGGG - Intronic
1088436326 11:109817094-109817116 ATGTGTATAATCAGGAAAGGAGG - Intergenic
1088795466 11:113263825-113263847 CTGTGTGTGCTCAGTAGAGAAGG + Intronic
1090066223 11:123505987-123506009 CTGATTGTAAACTGAAAAGATGG - Intergenic
1092556052 12:9563030-9563052 CTGCCTGAAATCAGAAATGACGG - Intergenic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1093147180 12:15580809-15580831 CTCAGTGTAATGAGAAAAGGAGG + Exonic
1093684007 12:22035724-22035746 CTGGGAGAAATCAGAAATGAGGG + Intergenic
1094516041 12:31127618-31127640 CTGCCTGAAATCAGAAATGACGG + Intergenic
1097622557 12:61958294-61958316 CTGTCAAAAATCAGAAAAGAAGG - Intronic
1098645520 12:72895662-72895684 GTGTGTGTGGTCAGAAAAGGAGG - Intergenic
1099661109 12:85563446-85563468 CATTATCTAATCAGAAAAGAAGG + Intergenic
1100327504 12:93553219-93553241 TTGTGTGTTATTAGTAAAGATGG + Intergenic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1100732428 12:97487241-97487263 GTGTGTGGAATCATAAAAAAAGG + Intergenic
1101736008 12:107463872-107463894 CTGCCTGGGATCAGAAAAGATGG + Intronic
1103843559 12:123885403-123885425 CTGTTAGTAATAAGAAAACAAGG - Intronic
1105812643 13:24008626-24008648 CTGTGTTTAATATGAAGAGAAGG + Intronic
1106599599 13:31176220-31176242 GTGTTTGTAATAAGAAAAGTTGG + Intergenic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1107957195 13:45526839-45526861 CTGTGAGGAATCAGAAGAGGTGG - Intronic
1109221021 13:59641194-59641216 CTGTGTGGAGACAGAATAGAAGG - Intergenic
1109674538 13:65657827-65657849 CTCTGTGTCATCAGAGAAAAAGG - Intergenic
1110983003 13:81926664-81926686 GTGTGTGTAATCATAAAGTATGG + Intergenic
1111286307 13:86096928-86096950 CTCTGTGTACTCAAAAGAGAGGG - Intergenic
1112317107 13:98372612-98372634 TTATATGTAATAAGAAAAGAGGG + Intronic
1112539374 13:100292640-100292662 CTGTCTGACATCTGAAAAGATGG + Intronic
1114157853 14:20127255-20127277 GTGTGTGTACTTTGAAAAGAAGG - Intergenic
1115863474 14:37715283-37715305 ATTTGTGTTATCACAAAAGATGG + Intronic
1119242693 14:73074608-73074630 TTGTTTAGAATCAGAAAAGATGG + Intronic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1122891728 14:104735142-104735164 CTGTGTGTGAGCAGGAAAGGGGG + Intronic
1126954930 15:53922826-53922848 CTGTGTCTTACCAGAAAAGTTGG + Intergenic
1127270050 15:57392316-57392338 CTGTGTGTGATCAGCCTAGAGGG + Intronic
1127689476 15:61380663-61380685 CTGTGTATAATCTGAGAAAAAGG + Intergenic
1127928916 15:63577454-63577476 CTGTCTGTACAAAGAAAAGAAGG + Intronic
1128615132 15:69102957-69102979 CTAAGTGGAATCAGAAAGGAAGG - Intergenic
1128673608 15:69593226-69593248 CTGTGGGTGGTCAGAAAAGGAGG + Intergenic
1129013564 15:72445232-72445254 CTGTGTGTAAAAAAAATAGAAGG - Intergenic
1129107552 15:73320040-73320062 GTGTGTGTAAGTAGAGAAGAGGG + Exonic
1130670167 15:85905109-85905131 TTTTGTGTGCTCAGAAAAGATGG - Intergenic
1132440149 15:101854479-101854501 CTGTGTGATCTCAGAAAAGCAGG - Intergenic
1133495322 16:6312279-6312301 CGCTGTGTAATCAGGAAACAAGG + Intronic
1137363671 16:47842284-47842306 CTGTGTGTAATGAAAAAGGTTGG - Intergenic
1138073744 16:54019877-54019899 CAGTGAGAGATCAGAAAAGAAGG + Intronic
1138316266 16:56072923-56072945 CAGTCTGGAATCAGAGAAGAAGG + Intergenic
1138740957 16:59309615-59309637 CTGTCTCTAATCCCAAAAGATGG - Intergenic
1139148222 16:64348179-64348201 CTTTGTGTGAGCAGAAATGATGG - Intergenic
1140243487 16:73226602-73226624 CTCTGTGCAATCAGCAAAGGTGG - Intergenic
1141990758 16:87608171-87608193 CTGGGTGTCCTCAGAAGAGAAGG - Intronic
1142389663 16:89790807-89790829 ATGAGTGAAATCAGGAAAGAGGG - Intronic
1144087007 17:11819049-11819071 ATGTTTGAAATCAGAGAAGAGGG - Intronic
1144289049 17:13807814-13807836 CTGAGAGTAATCAGAAATGCAGG + Intergenic
1145111653 17:20168847-20168869 ATGTTAGTAATCAGAAACGATGG + Intronic
1145281076 17:21467508-21467530 CTGTGTCTTCTCAGAAGAGATGG - Intergenic
1145396874 17:22503398-22503420 CTGTGTCTTCTCAGAAGAGATGG + Intergenic
1146840712 17:36152022-36152044 TTCTGTGTGAGCAGAAAAGAGGG + Intergenic
1147711388 17:42468746-42468768 CTGTTTGTCACCATAAAAGAGGG - Intronic
1150858413 17:68775348-68775370 CTCTGTAAAATCAGAAAACATGG - Intergenic
1152640260 17:81446385-81446407 CTGTGGGTAACCAGAAAAGGGGG - Intronic
1152894101 17:82900662-82900684 CTGCGTGTACTCAGGAAAGCCGG - Exonic
1203171861 17_GL000205v2_random:155739-155761 CTGTGTGTAGCAAGAAAAGATGG - Intergenic
1153791185 18:8581324-8581346 CTGTGTGTTAGCAGAAAATTTGG - Intergenic
1155382544 18:25239977-25239999 ATGTGTGTGATAAGATAAGATGG - Intronic
1157060452 18:44282138-44282160 ATATGTGTAATCAATAAAGATGG + Intergenic
1157747290 18:50147033-50147055 CTGTCTGTAAGGAGACAAGATGG - Intronic
1158602936 18:58870559-58870581 TTCTGTGTAGGCAGAAAAGACGG + Intronic
1158614342 18:58972324-58972346 GTGTGTATATTCAGAAAAGTGGG + Intronic
1158760241 18:60376406-60376428 CTGTGTGTAAGCAGAAGGTAAGG - Intergenic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159322331 18:66868006-66868028 CTGTGTGTAATCAGATTAGATGG + Intergenic
1159356592 18:67344733-67344755 ATGTAACTAATCAGAAAAGACGG + Intergenic
1159735218 18:72088424-72088446 CTTTATGTATTCAGAAAATATGG + Intergenic
1161729762 19:5952139-5952161 CTGGGTGTAAGCAGAACAAATGG - Intronic
1162276141 19:9656701-9656723 CTGTGTTTAATTTGAAAACAAGG - Intronic
1163319247 19:16563368-16563390 CTGTGTGTAATAAGGACAGAGGG + Intronic
1164220261 19:23186963-23186985 CTGTGTGTAATAAAAAATGTTGG - Intergenic
1164259019 19:23553125-23553147 CTGTGTGTAAGGAAAAAGGATGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166767133 19:45258401-45258423 ATGTGTGTAATTAGAAAAGGAGG + Intronic
925153291 2:1632092-1632114 CTCTCTGTAATCAGAACAGTGGG - Exonic
925475501 2:4209744-4209766 CTGTGTGTAACCAGAAACCCAGG + Intergenic
925533967 2:4895545-4895567 CTGTCAGTGTTCAGAAAAGAAGG - Intergenic
926859869 2:17298299-17298321 ATGAGTGTAATCACAAAGGAAGG - Intergenic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
928849255 2:35723218-35723240 TTGTTTGTAGTCAGCAAAGATGG - Intergenic
929633795 2:43494405-43494427 CTCTGTTTAATAAGAAAATAGGG + Intronic
930053300 2:47233757-47233779 CTCTGTATAATCAGAGAAGTAGG - Intergenic
931098860 2:58973130-58973152 CTGTGTTTAATGACAAAAGAAGG + Intergenic
931251867 2:60538777-60538799 GTGTGTGTAATGGGGAAAGAGGG + Intronic
931953013 2:67386242-67386264 CTGTGTGTAAGCAGAAACTGAGG + Intergenic
933241219 2:79922500-79922522 ATGTCTGTAATAAGAAGAGAAGG - Intronic
933529157 2:83484165-83484187 TTGTGTGTAAGAAGTAAAGAAGG - Intergenic
934014868 2:87869350-87869372 ATGTGTGTGTACAGAAAAGATGG - Intergenic
936796506 2:116212373-116212395 CTGGGTGATATCAGAAAAGTTGG - Intergenic
937249021 2:120511648-120511670 CTGTGTGGAATAATAAAAGCGGG + Intergenic
937835754 2:126468939-126468961 CTGTGTGTCCTGAGAAGAGAGGG - Intergenic
938656468 2:133439659-133439681 TGGTGTGTAGTCAGAAGAGAGGG - Intronic
939475695 2:142683724-142683746 CTGTGTTTAATGAGAAATTAAGG + Intergenic
939874508 2:147562405-147562427 ATCTTTGTAATCAGAAAAGTGGG - Intergenic
939901792 2:147859360-147859382 CTGTGTGTGATTAGAGAGGAGGG + Intronic
940308477 2:152251745-152251767 CTGTGTGTGACCAGAAATGTGGG + Intergenic
940705945 2:157105161-157105183 CTGAAGCTAATCAGAAAAGATGG + Intergenic
941140858 2:161779466-161779488 CTGGGTGAAATGAGAAAAGCAGG - Intronic
943503851 2:188728426-188728448 GTGTGTGTAAGCAGAAAGAACGG - Intergenic
944300721 2:198121778-198121800 CTGCCTGTATTCTGAAAAGATGG - Intronic
944517881 2:200530557-200530579 CTGTATGAAATCACCAAAGAAGG + Intronic
944752501 2:202724898-202724920 CTGTCTGTAATGAAAAAAGAGGG - Exonic
945236206 2:207634150-207634172 TTGTGTGTAATTAGAAAAGCAGG + Intergenic
945690512 2:213028787-213028809 ATGAGTGTAATAAGAAAATATGG - Intronic
947493409 2:230615251-230615273 CAGAGTGTAACCAGGAAAGATGG + Intergenic
948320872 2:237068137-237068159 CTCTGTGGAGTCAGAAAAGCTGG - Intergenic
1168743225 20:212902-212924 CTGGGTGTGATCAGAGAAGGTGG - Intergenic
1169860682 20:10148309-10148331 CTGTGAGAACTCACAAAAGAAGG - Intergenic
1173578361 20:44128258-44128280 CTGTTTCTAATAAGAAAAAATGG + Intronic
1174962591 20:55175075-55175097 CTGTGTGTAATAAGAAAAAAGGG + Intergenic
1175991788 20:62793510-62793532 CTGTGCCTATTGAGAAAAGATGG - Intergenic
1176327841 21:5517576-5517598 CTGTGTGTAGCAGGAAAAGATGG - Intergenic
1176399916 21:6303375-6303397 CTGTGTGTAGCAGGAAAAGATGG + Intergenic
1176437241 21:6685729-6685751 CTGTGTGTAGCAGGAAAAGATGG - Intergenic
1176461503 21:7012799-7012821 CTGTGTGTAGCAGGAAAAGATGG - Intergenic
1176485064 21:7394577-7394599 CTGTGTGTAGCAGGAAAAGATGG - Intergenic
1177244516 21:18505431-18505453 CTTTGTGTACTCATAAAACAGGG + Intergenic
1177390063 21:20456837-20456859 CTGTGTAAAATAAGAATAGAAGG - Intergenic
1177594989 21:23227018-23227040 CTGTGTGTAGTCATAAACGTAGG + Intergenic
1177595697 21:23239594-23239616 CTGTAGGTAATCAGATAATATGG - Intergenic
1179381687 21:40905285-40905307 ATGTGTGTAAGGGGAAAAGAAGG + Intergenic
1179570658 21:42276853-42276875 CAGTGTGGAAGCAGAACAGACGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184078306 22:42198631-42198653 CTGTATATATTCAGAACAGATGG + Intronic
1184285309 22:43467416-43467438 CTGTGTGTAACCTGAACAGGCGG - Intronic
949644667 3:6078890-6078912 CTGTGTGTAAAGAGAACACATGG - Intergenic
950409501 3:12826071-12826093 CTGTCTGTAATCAGCAGAGTTGG - Intronic
950554610 3:13687832-13687854 CTGTTTGTTATCAGAAGGGAGGG + Intergenic
950719496 3:14872572-14872594 CTGTGGATATTCATAAAAGAAGG + Intronic
950797071 3:15518912-15518934 CTGTGTATACACAGAAAATAAGG - Intronic
952894963 3:38072493-38072515 CTGTGTGTAATGAAAAGAGTTGG + Intronic
953157343 3:40387060-40387082 GTGAGAGCAATCAGAAAAGAAGG + Intergenic
953487879 3:43319465-43319487 CTGGGTGTAAAAATAAAAGAGGG + Intronic
953840905 3:46389598-46389620 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
954865319 3:53724059-53724081 CTGAGTGTGAGCAGACAAGAAGG - Intronic
954897981 3:53993589-53993611 CTTTGTGTTATGAGAAAAGAAGG - Intergenic
954991665 3:54845996-54846018 CTGCCTGTAATAAGGAAAGAGGG - Intronic
955463404 3:59210395-59210417 CAGGATGTAATCAGAGAAGAAGG - Intergenic
957062908 3:75496674-75496696 CTGTGTGTAATGAGAAATACAGG - Intergenic
957324388 3:78674314-78674336 CTGTTTGCAAACAGTAAAGAAGG + Intronic
958026534 3:88057148-88057170 ATAAGTGTAATCAGAAACGATGG + Exonic
958716211 3:97785302-97785324 ATTTATGTAATCAGAAAAAAGGG - Intronic
958723186 3:97871584-97871606 ATGTATGTAATCAGGTAAGAAGG + Intronic
959436957 3:106327268-106327290 CTGTCTGTAAACAAAGAAGAGGG + Intergenic
961197757 3:125017543-125017565 ATGGCTATAATCAGAAAAGATGG + Intronic
961712516 3:128838538-128838560 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
963067675 3:141276575-141276597 CTGTTTGTAATAACAAAAAAGGG - Intronic
963828019 3:149976196-149976218 CTGTATGTAACCAGGAAAAATGG - Intronic
963865378 3:150355113-150355135 CTGTTAGTACTCAGAAGAGAGGG - Intergenic
964300023 3:155277174-155277196 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
965042012 3:163520343-163520365 CTGTGTGTGACCAGAATAGATGG + Intergenic
965441515 3:168720944-168720966 CTGTGGGTCAACAGACAAGAAGG - Intergenic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
967485758 3:190028460-190028482 TTGTGTGTCAACAGAAAAGATGG - Intronic
968413013 4:405569-405591 CTGTGTGTAATGAAAAATGTTGG + Intergenic
969815693 4:9685760-9685782 GTGTTTGTAAACACAAAAGAAGG - Intergenic
970249114 4:14095155-14095177 CTCTGTGTAAGGAGAAAAAAAGG - Intergenic
971643478 4:29165876-29165898 TTATGTGATATCAGAAAAGATGG + Intergenic
971781932 4:31047135-31047157 ATTTGTGTAATCAGAGAAAAAGG - Intronic
972086344 4:35221597-35221619 GTTTGTGTAATGAGACAAGAAGG - Intergenic
972165248 4:36276031-36276053 CTGTCTGCAAGCAGAAAAAATGG - Intergenic
973028686 4:45308054-45308076 CTGTGTGTAAACAAAAAAAAAGG - Intergenic
974655531 4:64814844-64814866 TTGTATGTCATGAGAAAAGAAGG + Intergenic
976339286 4:83928002-83928024 CTGTGTCAAATTAGAAAAAAAGG - Intergenic
976434076 4:84996770-84996792 ATGTGTTTAATCATAAAAGATGG + Intergenic
977237644 4:94527828-94527850 GTGTGAGTAAACAGAGAAGAGGG + Intronic
977786472 4:101040885-101040907 CTCTGTATAAATAGAAAAGAAGG - Intronic
978303027 4:107292577-107292599 CTGTGTGTAATGAAAAGAGTTGG + Intergenic
978556744 4:109989117-109989139 CTGTGTGTATAAAGAAAAGGAGG + Intronic
978885892 4:113766004-113766026 CTGTGTAAAATGAGAAAAAAAGG - Intergenic
979466337 4:121042829-121042851 TTGTGTGAAATGAGAACAGAAGG - Intronic
979841028 4:125440485-125440507 CTGTGTGTGATCAGAGATGCAGG - Intronic
981746234 4:148055058-148055080 CAGTGTGGAATCAGGTAAGAGGG - Intronic
982031344 4:151304164-151304186 CTGAGTGACATCAGAAAAAATGG + Intronic
982677233 4:158389830-158389852 CTATTTGTAATAAGAGAAGATGG - Intronic
983003537 4:162451902-162451924 CTGAGTGTGATCTGAAAAGGAGG - Intergenic
983396930 4:167210584-167210606 ATGTGTGTATTTAGCAAAGAAGG + Intronic
984094099 4:175412536-175412558 TTATGAGTAATGAGAAAAGAAGG - Intergenic
984453902 4:179940553-179940575 CTGCTTGTAATTAGAAGAGAAGG + Intergenic
984837748 4:184038272-184038294 CTGTGTGTATACGGGAAAGATGG - Intergenic
985276374 4:188241853-188241875 CTTTGTGTATTTAGTAAAGATGG + Intergenic
985299677 4:188474871-188474893 CTGAAGATAATCAGAAAAGATGG + Intergenic
986179368 5:5379085-5379107 CTGTGTGGGAACAAAAAAGAAGG - Intergenic
986790573 5:11155596-11155618 CTGTGGGTGATCAGAAGGGAAGG - Intronic
987426211 5:17776451-17776473 CTGTGTGTCATCAGAGATGATGG + Intergenic
987562830 5:19546319-19546341 TTTTGTGTCATCAGAAAAGTGGG + Intronic
989283624 5:39673544-39673566 CTGTGTTTAGTCAGAAAAGCAGG + Intergenic
990042933 5:51394747-51394769 TTGTTTGTAAACATAAAAGAGGG - Intergenic
990193897 5:53291052-53291074 TTGTTTGTAAAAAGAAAAGAAGG + Intergenic
990341014 5:54823228-54823250 CTCTGAGTCATCAGAGAAGAGGG - Intergenic
990564937 5:57019354-57019376 CTGTGTGTAATGAAAAAAGTTGG + Intergenic
991393632 5:66178532-66178554 CTTTGTGTTCTCATAAAAGATGG - Intronic
991726711 5:69542743-69542765 CTGTGTGTAATCAGAAAAGAAGG - Intronic
991868246 5:71085131-71085153 CTGTGTGTAATCAGAAAAGAAGG + Intergenic
992262793 5:74987573-74987595 CCCTGTGCCATCAGAAAAGAAGG - Intergenic
993084703 5:83349173-83349195 ATGTGTGTAACCAGAGAAGTGGG - Intronic
993433924 5:87867424-87867446 CTTTGTGTAAGCCGAGAAGAGGG - Intergenic
994628784 5:102255272-102255294 AGGTGTGTAATCAGAAAGGAAGG - Intronic
996723847 5:126656372-126656394 ATGTATTTTATCAGAAAAGACGG + Intergenic
996725678 5:126671948-126671970 CTGTGTGTAATGAAAAAGGTTGG + Intergenic
996917864 5:128732851-128732873 CTGTGTGTAATGAAAAAGGTTGG - Intronic
997623653 5:135317383-135317405 CTGTGTTTCTTCAGAAAACAAGG + Intronic
998685514 5:144519737-144519759 CTTTGTTTATTCAGAAAACAAGG + Intergenic
998799425 5:145854246-145854268 CTGTGTTTAATTAGAAAATGAGG + Intergenic
999995487 5:157088324-157088346 GTGTGTATAATCAGGAACGAAGG + Intronic
1000588394 5:163128383-163128405 ATGTTTGTATTCTGAAAAGAGGG + Intergenic
1001500160 5:172225237-172225259 ATGTATGAAATCAGAACAGAAGG - Intronic
1004856418 6:19755667-19755689 CTGTGTGTAAATGGAAAAGAAGG + Intergenic
1006277073 6:33013651-33013673 ATGTGTGTAAAGAGAAAGGAGGG + Intergenic
1007121523 6:39386079-39386101 CTGTGTCAAATAAAAAAAGATGG + Intronic
1010386146 6:75283331-75283353 GTGTGTATAAACAGAACAGAAGG + Intronic
1010842715 6:80666708-80666730 CTGTCTGTCATCAGGAAAGATGG - Intergenic
1011983324 6:93414143-93414165 CTGTTATTAATCAGAAATGATGG - Intronic
1012335671 6:98053460-98053482 CTTTGTTTATTCAGAAAAGCAGG - Intergenic
1013323639 6:109021778-109021800 CTATGTTGAATCAGAAAAAAAGG + Intronic
1013842021 6:114407798-114407820 CTGAGAGTATTCAGAAAAGTGGG + Intergenic
1014952502 6:127573655-127573677 CTCTGTGTAATAAGAAATAATGG + Intronic
1015058910 6:128938722-128938744 CAGTTTGTAATCAGAAATGAAGG + Intronic
1017215682 6:151903265-151903287 CTGTGTCTAATCAGAAAGTTAGG + Intronic
1017587011 6:155937650-155937672 ATCCTTGTAATCAGAAAAGAGGG - Intergenic
1017672809 6:156782776-156782798 CTGTGTATAGTTAGAAAAGGTGG + Intronic
1018071827 6:160171434-160171456 CAGTCTGGAATGAGAAAAGATGG + Intronic
1018733063 6:166667894-166667916 CTGAGTGTACAAAGAAAAGAGGG + Intronic
1019462660 7:1169264-1169286 CTGTGTCCAAGCAGAAGAGAGGG + Intergenic
1020287203 7:6693266-6693288 CTATGTGGAATGAGGAAAGAAGG - Intronic
1020778630 7:12490248-12490270 CTGCTTGTAATCATAATAGAGGG + Intergenic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1021136922 7:16976487-16976509 AATTGTGTAATTAGAAAAGATGG + Intergenic
1023491288 7:40745011-40745033 ATGTATGTAATTAGAAGAGAGGG - Intronic
1023674716 7:42617470-42617492 CTGTGTGCAAGCAGGAGAGAGGG - Intergenic
1024555928 7:50603737-50603759 CTGTATGAAATCTGAAGAGATGG - Intronic
1026220226 7:68389830-68389852 CTGTGTTTATTCATAAAACATGG + Intergenic
1027194588 7:76020917-76020939 CTTTGTGAAATCAGCAAAGAAGG + Intronic
1027505547 7:79013378-79013400 CTGTGAGGAATTAGAAGAGAAGG + Intronic
1029317429 7:99727148-99727170 CTGTGTGTAATGAAAAGAGTTGG - Intronic
1029504320 7:100953085-100953107 ATGTCTGTACTCAGAGAAGATGG - Exonic
1029504626 7:100955341-100955363 GTGTCTGTACTCAGAGAAGATGG - Exonic
1029505159 7:100959208-100959230 ATGTCTGTACTCAGAGAAGATGG - Exonic
1033168783 7:139065313-139065335 CGGCGTGGCATCAGAAAAGAGGG - Intronic
1033945837 7:146716504-146716526 CTGTGTGGCATCAGAAACAAAGG - Intronic
1035617656 8:1014023-1014045 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035617843 8:1015401-1015423 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035617864 8:1015560-1015582 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035617952 8:1016235-1016257 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035618137 8:1017590-1017612 CTGTGTGTGACCAGGACAGACGG + Intergenic
1036721061 8:11175866-11175888 CTGTTTGTAATAAAAAAAGATGG - Intronic
1038133114 8:24756160-24756182 CTGTGTGAAATGGGAAAATATGG + Intergenic
1041454405 8:58042161-58042183 ATGTGTGGAATCTAAAAAGATGG - Intronic
1042706314 8:71668031-71668053 CTGTGTGTAATGAAAAAGGTTGG - Intergenic
1043599083 8:81917165-81917187 GTGTGTGTAATGAAAAAAAAAGG - Intergenic
1045234048 8:100334323-100334345 CTGTGTGGAAACAGAGCAGAGGG - Intronic
1045731579 8:105248033-105248055 TTGTCTGTAATCAGAAAAATAGG - Intronic
1046075093 8:109304142-109304164 CTGTGTGTAATGAAAAAGGTTGG - Intronic
1046133415 8:109996363-109996385 CTGTGGGTAATGAGAAATGCTGG - Intergenic
1046715654 8:117563649-117563671 CAGAGTGTTAACAGAAAAGAAGG - Intergenic
1048446702 8:134498102-134498124 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446717 8:134498161-134498183 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446732 8:134498220-134498242 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446774 8:134498397-134498419 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446789 8:134498456-134498478 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446804 8:134498515-134498537 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446819 8:134498574-134498596 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446834 8:134498633-134498655 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446864 8:134498751-134498773 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446880 8:134498811-134498833 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446910 8:134498929-134498951 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446925 8:134498988-134499010 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446940 8:134499047-134499069 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446955 8:134499106-134499128 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446983 8:134499224-134499246 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048446998 8:134499283-134499305 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048447026 8:134499401-134499423 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048447038 8:134499460-134499482 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048447051 8:134499519-134499541 CTGTGTGTAACCAGCAACGGGGG - Intronic
1048447081 8:134499637-134499659 CTGTGTGTAACCAGCAACGGGGG - Intronic
1049139058 8:140934932-140934954 CTGTGTTTATGCAGAAAAGGAGG + Intronic
1049153797 8:141055044-141055066 CTCAGGGTAATCAGAACAGAGGG - Intergenic
1050640261 9:7660045-7660067 ATGTGTGTAATTAGAAAATTAGG + Intergenic
1051103878 9:13555137-13555159 CTGTTTGTAATCTGAAAGGAGGG - Intergenic
1051133762 9:13894163-13894185 ATGTGTGTAAGCAGGAAGGAGGG + Intergenic
1051623170 9:19073120-19073142 CTCTGTGAAATCAGTAAGGAAGG + Intronic
1052042326 9:23752904-23752926 CTGAGTGGAGTCTGAAAAGATGG + Intronic
1053402646 9:37839779-37839801 TTGTGTGGAATAAGCAAAGAGGG - Intronic
1053649794 9:40155232-40155254 TTGGGTGTGATAAGAAAAGAAGG - Intergenic
1053755956 9:41308711-41308733 TTGGGTGTGATAAGAAAAGAAGG + Intergenic
1054330304 9:63746997-63747019 TTGGGTGTGATAAGAAAAGAAGG - Intergenic
1054534787 9:66220972-66220994 TTGGGTGTGATAAGAAAAGAAGG + Intergenic
1060100088 9:120832697-120832719 CTGTGTTTATTCAGCAAAAAAGG - Intronic
1202797683 9_KI270719v1_random:139882-139904 TTGGGTGTGATAAGAAAAGAAGG - Intergenic
1203434265 Un_GL000195v1:122882-122904 CTGTGTGTAGCAAGAAAAGATGG + Intergenic
1190636735 X:52442163-52442185 ATGTGTGGAATCAGAAAGAAAGG - Intergenic
1192415242 X:70973949-70973971 CAGTATGTAATCACTAAAGATGG + Intergenic
1193609333 X:83610138-83610160 TTGTGTGTAAGGAGTAAAGAAGG + Intergenic
1193815478 X:86100423-86100445 ATGTGTGTAAAAAGAAAGGAAGG - Intergenic
1194737298 X:97527783-97527805 CTGTGTGAAATCTCAAAATAGGG + Intronic
1196632770 X:117962476-117962498 ATGTGTGTAATCAATGAAGATGG + Intronic
1196789706 X:119452711-119452733 CTTTTTGGAATCAGGAAAGATGG - Intronic
1197313261 X:124931985-124932007 CTTTGTGGAACCAGAAATGATGG - Intronic
1199129611 X:144169161-144169183 ATGTGTGTGTACAGAAAAGATGG + Intergenic
1200007548 X:153097831-153097853 CTGTGTGTAAGGAAAAAGGATGG + Intergenic