ID: 991745750

View in Genome Browser
Species Human (GRCh38)
Location 5:69738911-69738933
Sequence GTGAAGAATAGGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991745744_991745750 9 Left 991745744 5:69738879-69738901 CCTCTAATTCTATGAGCTTTGCT No data
Right 991745750 5:69738911-69738933 GTGAAGAATAGGAAAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991745750 Original CRISPR GTGAAGAATAGGAAAGGGGG AGG Intergenic
No off target data available for this crispr