ID: 991746968

View in Genome Browser
Species Human (GRCh38)
Location 5:69752954-69752976
Sequence ACATTTTTACTGATGGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991746964_991746968 11 Left 991746964 5:69752920-69752942 CCTGGTGATCATGTGTCCGGCTA No data
Right 991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG No data
991746966_991746968 -5 Left 991746966 5:69752936-69752958 CCGGCTAAGCATTAGAGGACATT No data
Right 991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991746968 Original CRISPR ACATTTTTACTGATGGCGAA AGG Intergenic
No off target data available for this crispr